Original Research Paper

Gene Expression of Aromatases, Steroid Receptor, GnRH and GTHs in the Brain during the Formation of Ovarian Cavity in Red Spotted Grouper, Epinephelus akaara

Hyun Kyu Kim1, Jung-Hyun Kim1, Hea Ja Baek2, Joon Yeong Kwon1,
Author Information & Copylight
1Dept. of Aquatic Life Medical Science, Sunmoon University, Asan 31460, Korea
2Dept. of Marine Biology, Pukyong National University, Busan 48513, Korea
Corresponding Author : Joon Yeong Kwon, Dept. of Aquatic Life Medical Science, Sunmoon University, Asan 31460, Korea. Tel : +82-41-530-2284, Fax : +82-41-530-2917, E-mail : jykwon@sunmoon.ac.kr

Copyright © 2016 The Korean Society of Developmental Biology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Oct 26, 2016 ; Revised: Nov 27, 2016 ; Accepted: Dec 20, 2016

Published Online: Dec 31, 2016

ABSTRACT

Red spotted grouper, Epinephelus akaara, is a popular aquaculture species and a protogynous hermaphrodite. Induction of artificial sex change at the time of primary sex differentiation is of interest but has not been successful due to the lack of necessary basic information. To find out the potential neuroendocrine influence on the primary sex differentiation, the expression of key genes in the brain was investigated during the formation of ovarian cavity. Expression of cyp19a1b, esr1, gnrhr1, fsh, lh and cga in the brain was positively associated with the formation of ovarian cavity, showing gradual increase as the formation proceeds. However, the expression of gnrh1 was suppressed during the early part of the ovarian cavity formation, signifying potential hypothalamic influence on the primary sex differentiation in this species.


INTRODUCTION

Red spotted grouper, Epinephelus akaara, is a popular aquaculture species in tropical and sub-tropical areas. This species is known to be a protogynous hermaphrodite that first differentiates into female and changes to male later (Tanaka et al., 1990; Okumura, 2001; Li et al., 2006; Li et al., 2007; Kim et al., 2015). The success of seed production in this species is largely dependent on the timely supply of male because natural sex change takes place long time after the primary sex differentiation at around 5 to 6 years old (Li et al., 2006; Li et al., 2007). Thus, induction of artificial sex change at the time of primary sex differentiation could be a highly useful technique. To achieve this, however, further understanding on the process of primary sex differentiation is essential.

Classical concept of sexual differentiation in vertebrates suggests that the result of gonadal sex differentiation drives brain sex differentiation. It could be different particularly in the case of hermaphrodite fish. Serially sex changing teleosts demonstrate profound change in sexual behavior even before the gonadal trans-differentiation into a testis or an ovary indicating the influence of the brain (Grober & Sunobe, 1996; Kobayashi et al., 2013). There are huge amounts of evidences that support the involvement of the brain in the process of sex change in protogynous hermaphrodite (reviewed by Baroiller et al., 1999). However, the influence of brain in the process of primary sex differentiation in hermaphrodite fish has not been sufficiently investigated yet.

It is well known that the primary sex differentiation is under the influence of sex steroid hormones in fishes (Yamazaki, 1983; Hunter & Donaldson, 1983; Nakamura et al., 1998). Cytochrome P450 aromatase, a steroidogenic enzyme that converts androgens into estrogens, is also deeply associated with sex differentiation in fish (Kwon et al., 2001; Guiguen et al., 2009). This enzyme is encoded by two distinct genes (cyp19a1a: P450aromA-ovary type; cyp19a1b: P450aromB-brain type) in various fish species (Kwon et al., 2001; Kwon & Kim, 2013). The action of estrogen is mediated by estrogen receptor. However, the importance of estrogen receptor in the brain has not been properly explored so far with regard to gonadal sex differentiation in this species.

Several studies suggested that the importance of feedback regulation of gonadal steroids to orchestrate GnRH-GTH release, which subsequently regulate sex steroid production during gametogenesis, serial sex change and natural sex reversal (Peter et al., 1991; Grober & Sunobe, 1996; Goos et al., 1999; Zohar et al., 2010). As mentioned earlier, Baroiller et al. (1999) also suggested that the hypothalamic gonadotrophic axis may be needed to complete sex differentiation though not activate it.

The formation of the ovarian cavity is a characteristic landmark for the process of primary gonadal sex differrentiation in red spotted grouper (Kim et al., 2015). In many fish species, ovarian cavity are unequivocally discernible, allowing for the rapid identification of ovarian differentiation and detection any effects of estrogens or other sex steroids on gonadal differentiation (Dietrich & Krieger, 2009).

To find out the potential neuroendocrine influence on the primary sex differentiation of protogynous hermaphrodites, we investigated the expression of two aromatase genes (cyp19a1a and cyp19a1b), estrogen receptor alpha (esr1), GnRH and GnRH receptor genes (gnrh1 and gnrhr1) and three gonadotropin subunit genes (FSHβ fsh, LHβ lh and common glycoprotein alpha cga) in the brain of red spotted grouper during the formation of ovarian cavity.

MATERIALS AND METHODS

1. Fish and tissue sampling

Red spotted grouper, E. akaara was obtained from Cheongsol aquaculture farm in Muan-gun, Jeonnam, Korea, and transported to a fish rearing facility in Sunmoon University. Fish were reared at 27±1℃ and 31± 1‰ in indoor tanks. Photoperiod was maintained at 14 hours light : 10 hours dark (14L:10D). Fish were fed a commercial diet (40 to 80 DPH, days post-hatch: Ottohime, Japan; 80 to 130 DPH: Myungsun, Korea) ad libitum twice a day. Sampling was carried out every 5 days between 40 to 105 DPH (n=7-8 at each sampling date). After that, fish were sampled additionally at 120 (n=4) and 130 DPH (n=3). These fish were anesthetized by 50 ppm benzocaine (Sigma, USA) and killed to remove whole brain including the pituitary. The brain of fish from 40 to 70 DPH was removed together with cranium and surrounding tissues because the size of the brain was tiny. The brain of fish from 75 to 130 DPH was removed only with the pituitary out of the head part.

2. Identification of esr1, gnrh1 and gnrhr1 in the brain of red spotted grouper

Sequences for esr1, gnrh and gnrhr1 of red spotted grouper were not available in GenBank database since these genes have not been studied previously in this species. To identify these genes and obtain partial sequences, degenerate PCR was conducted using sequence information from the related species. Total RNA was extracted from the brain including the pituitary using TRIsure (Bioline, USA) and quantified using nanodrop-1000 (Thermo, USA). This RNA (1 μg) was reverse transcribed using TOPscritTM RT DryMIX (Enzynomics, Korea). The resultant cDNA was used as a template for subsequent degenerate PCR. Electrophoresis of PCR products were carried out in 1% agarose gel. All primers for degenerate PCR were designed using the Primer 3 software (version 2.2.3) and listed in Table 1. The degenerate PCR was carried out using GoTaq Green Master Mix (Promega, USA). The condition for degenerate PCR was as follows: initial denaturation at 95℃ for 5 min, 40 cycles of denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds and elongation at 72℃ for 1 min. PCR products were then sequenced by 3730xl DNA Analyzer (Applied biosystems, USA).

Table 1. Primers used for degenerate PCR to identify red spotted grouper estrogen receptor alpha, GnRH1 and GnRH receptor 1 gene
Genes Primer sequence
Estrogen receptor alpha Forward 5’- CAGTGACATGTATCCCGAAGAG- 3’
Reverse 5’- CTCAGATGTTGCCGTCTCATAG- 3’
GnRH1 Forward 5’- GCCTCCTGCACAGAAGAAT- 3’
Reverse 5’- AATCCTTTGGTTCTGTAAATCTTGG- 3’
GnRH receptor 1 Forward 5’- GCAGTAACCTCGCCCTATTT- 3’
Reverse 5’- CTTCTGTCCTCTGATTGGCTAC- 3’

using the Primer 3 software (version 2.2.3) and Beacon

Download Excel Table
3. Expression of cyp19a1a, cyp19a1b, esr1, gnrh1, gnrhr1, fsh, lh and cga in the brain

Extraction, quantification and reverse transcription of total RNAs were the same as described earlier in this study. Expression of cyp19a1a, cyp19a1b, esr1, gnrh1, gnrhr1, fsh, lh and cga in the brain of red spotted grouper during the formation of ovarian cavity was investigated by quantitative real time -PCR (qRT-PCR) using the resultant cDNAs as templates. Primers for qRT-PCR were designed Designer software (Bio-Rad, Hercules, CA, USA), and listed in Table 2. The qRT-PCRs were carried out using Topreal™ qPCR 2× PreMIX SYBR Green (Enzynomics, Korea) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Abundance level of each mRNA was normalized against the amount of β-actin mRNA. Relative abundance was determined using the comparative threshold cycle method, 2−△△Ct, along with CFX Manager™ Software (Bio-Rad). Relative expression values of all samples were categorized and analyzed on the basis of day post-hatch and the status of ovarian cavity formation.

Table 2. Primers used for quantitative real-time PCR to investigate the expression of P450aromA, P450aromB, estrogen receptor alpha, GnRH1, GnRH receptor 1, FSHβ, LHβ and common glycoprotein α
Genes(Accession number) Primer sequence Product length
Aromatase-a(AY547354) Forward 5’- ACGCCATAGAAAGTCTTGTAG - 3’ 79
Reverse 5’- GCAGTGAAGTTGATGTTATCG - 3’
Aromatase-b(AY547353.1) Forward 5’- GGAGGTCCTTCTGGAATGTAAAC - 3’ 102
Reverse 5’- CCGACGTTCTGAGCAAAGATAA - 3’
Reverse 5’- GCCCATTTGACCACTTTGAC - 3’
Estrogen receptor alpha Forward 5’- CAACTCTGGTGCCTTCTCTTT - 3’ 119
Reverse 5’- CCGACTGGCTGATATGATGTATG - 3’
GnRH1 Forward 5’- GACACACCGGGCAATATTCT - 3’ 79
Reverse 5’- GTGATTCCTCCACACAACCA - 3’
GnRH-receptor1 Forward 5’- TGTGCTGGACTCCGTACTA - 3’ 110
Reverse 5’- CAGGTTCCCAAACAGGAAGA - 3’
FSHβ(KJ534537.1) Forward 5’- GACTGGACCTATGAGGTGAAAC - 3’ 147
Reverse 5’- AAAGGACAGACAGCTGGATATG
LHβ(KJ534538.1) Forward 5’- GGGAGCCTCATCTTCCATTT - 3’ - 3’ 108
Reverse 5’- TTTGGACAGCCTTCCTTCTC - 3’
Common glycoprotein α(AY207430.1) Forward 5’- CGATCCCGAAGAACATCATCTC 96
Reverse 5’- CTGTGTGGTTTCTCACCCTTAT - 3’ - 3’
β-actin(HQ007251) Forward 5’- GACCTCACAGACTACCTCAT - 3’ 96
Reverse 5’- GCTTCTCCTTGATGTCACG - 3’
Download Excel Table
4. Histology

Fish were first fixed in 10% formalin for 12 hours. After removing the head and tail from the fixed fish, the remaining tissues (trunk part) were further fixed in 10% formalin again for another 12 hours. The fixed tissues were then dehydrated with ascending alcoholic series, cleared in xylene, and embedded in paraffin wax. Tissues were cut into a thickness of 5-8 μm, stained with haematoxylin & eosin. Tissue sections were observed under light microscope (DM500, Leica, Germany) to judge the status of ovarian cavity formation individually.

5. Statistical analysis

Data were presented as mean±SEM. Statistical differences of mRNA expression between different DPH was analyzed by Mann-Whitney U-test (P<0.05). Statistical differences of mRNA expression levels between different phases of ovarian cavity formation was analyzed by one-way ANOVA and Games-Howell range tests (P<0.05). Statistical analyses were performed using SPSS version 18.0.

RESULTS & DISCUSSION

1. Identification of esr1, gnrh1 and gnrhr1 in the brain of red spotted grouper

Degenerate PCR successfully amplified a prominent band for each gene from the brain of red spotted grouper. The size of PCR product for esr1, gnrh1 and gnrhr1 were 523, 252 and 884 base pairs (bp), respectively (Table 3). The sequences of these fragments exhibited 96-99% sequence identity to estrogen receptor alpha (accession number: HQ662335, HM030760) and GnRH-receptor1 (accession number: DQ536435) of other grouper species such as E. coioides, E. adscensionis, E. fasciatus.

Table 3. Partial cDNA sequences of GnRH1, GnRH-receptor 1 and estrogen receptor alpha genes of red spotted grouper obtained in this study
Genes (size) Sequence (5’ → 3’)
Estrogen receptor alpha(523 bp) TCATACTGGACAGGACCGAAGGCAACTGTGTCGAAGGCATGGCTGAGATCTTTGACA
TGCTGCTGGCCACTGCCTCCCGCTTCCGCTTGCTCAAACTCAAACCCGAGGAGTTTG
TCTGTCTCAAAGCCATCATCTTGCTCAACTCTGGTGCCTTCTCTTTCTGCACCGGCA
CAATGGAGCCCCTCCATGACACCACAGCGGTGCAGAACATGCTTGACACCATCACAG
ATGCTCTCATACATCATATCAGCCAGTCGGGATGCTCGGTTCAGCAGCAGTCGAGAC
GGCAGGCCCAGCTGCTGCTTCTGCTCTCACACATCAGGCACATGAGCAACAAAGGCA
TGGAGCATCTCTACAGCATGAAGTGCAAGAACAAAGTGCCTCTGTACGACCTGCTCC
TGGAGATGCTGGATGCTCACCGCATCCAACGCCCTGACAAACCAGGTCAGACCTGGT
CCCAGGCTGATGGGGAGCCTCCCTCCAGCACCAGCAGCAGCGGTGGTTCCTCTTCTT
CAGCTGGCTC
GnRH1(252 bp) TGCCTCCTGCACAGAAGAATGGCTGCAAAATCCTTGGCACTGTGTCTGCTGCTTGTG
GGAGCAATGTTGCCACAGGGCCACTGTCAGCACTGGTCATATGGGCTGAGCCCGGGA
GGGAAGAGGGATCTGGACAGCCTCTCGGACACACCGGGCAATATTCTTGAGGGGTTT
CCACATGTGGACACACCCTGCAGTGTTTTTGGTTGTGTGGAGGAATCACCTTTTGCC
AAGATTTACAGAACCAAAGGATTA
GnRH-receptor 1(884 bp) GTCTGGCGTCTCACCTGCGGCCGTTAATGCTGAGCCTGGCGTCAGCTGACCTGATGA
TGACATTTGTGGTGATGCCTCTGGATGCCGTGTGGAACGTTACAGTGCAGTGGTATG
GAGGAGACGTGCTCTGTAAGCTGCTCTGCTTCCTGAAGCTGTTCGCCATGCACGCCT
CCGCCTTCATCCTTGTTGTCATCAGCCTCGATCGCCAGCACGCCATCCTGCACCCGC
TGGACGCCCTGAACGCACACCGCAGGAACCGACGCATGCTGCTGCTGGCCTGGAGCC
TCAGCCTGGTGCTTGCATCACCACAGCTGTTTATCTTCCGGACGATCAGGGTGGAGG
CCGTGGACTTCACTCAGTGTGCCACTCACGGCAGCTTCAGCCACCGCTGGCAGGAAA
CTGTTTACAACATGTTTCACTTCATCACGCTGTACGTCGTCCCCCTGCTGGTGATGA
GCTGCTGCTACAGCCGCATCCTGCTGCACATCCACCTGCAGCACCTGAGAGACAAAG
CAGGTGAGTCGTACCTGCGTCGCAGCGGCACTGACATCATCCCAAAGGCTCGCATGA
AGACTCTGAAGATGACGGTGGTCATCGTGCTGTCCTTTGTGGTGTGCTGGACTCCGT
ACTACCTGCTGGGGATTTGGTACTGGTTCCAGCCCGACATGCTGCGCGTCACACCTG
AGTACGTACACCACGCCCTCTTCCTGTTTGGGAACCTGAACACCTGCTGCGACCCCG
TCATCTACGGCTTCTACACGCCATCCTTCAGGGCCGACCTCGCCGCCTGCTGCCGCA
GGACGAAGAGCGACGCTTCACTGCGATCTCCGGACCGACTGTCTGCCAGGCAGGATC
CTCACAGCGCGGAGCATGAGGCGGACCCC
Download Excel Table
2. Aromatase and estrogen receptor genes in the brain during the formation of ovarian cavity

Based on the gonadal histology, the major period of ovarian cavity formation was found to be 65 to 105 DPH in this species. All genes investigated in this study were detectable in the brain earlier than this period (40 to 60 DPH) but not high enough to compare with the expression levels during the ovarian cavity formation.

P450aromA mRNA (cyp19a1a) in the brain significantly increased at 70 and 90 DPH from the respective previous sampling date (Fig. 1). The levels tended to increase as the formation of ovarian cavity proceed but this increase was not statistically significant (P>0.05). P450aromB mRNA (cyp19a1b) increased significantly from 75 DPH and remained high during the rest of period investigated. As the formation of ovarian cavity proceed, the level of cyp19a1b expression increased significantly (Fig. 2, P< 0.05). Our findings are in agreement with previous studies for other fish species where cyp19a1a was contributable to gonadal sex differentiation (Kwon et al., 2001; Patil & Gunasekera, 2008; Guiguen et al., 2009) wherase cyp19a1b was highly expressed in the brain and might cause the brain sex differentiation (Vizziano-Cantonnet et al., 2011). However, highly expressed cyp19a1b in the brain is not likely to be the cause of the ovarian cavity formation since it was low at the onset of the formation.

dr-20-4-367-g1
Fig. 1. Expression of P450aromA mRNA (cyp19a1a) in the brain at different days post-hatch (a) and at differrent phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM. * indicates significant differrence from the respective previous DPH (P<0.05). Different letters on top of each bar indicate significant difference (P<0.05).
Download Origianl Figure
dr-20-4-367-g2
Fig. 2. Expression of P450aromB mRNA (cyp19a1b) in the brain at different days post-hatch (a) and at differrent phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM. * indicates sig nificant differrence from the respective previous DPH (P<0.05). Different letters on top of each bar indicate significant difference (P<0.05).
Download Origianl Figure

Estrogen receptor alpha mRNA (esr1) in the brain of red spotted grouper significantly increased from 90 DPH and remained high during the rest of period investigated. As the formation of ovarian cavity proceed, the level of esr1 expression increased significantly (Fig. 3, P<0.05). Brain aromatase activity is correlated to sex steroid levels, and the high expression of cyp19a1b is associated to an autoregulatory loop through which estrogens and aromatizable androgens up-regulate aromatase expression. This process requires estrogen receptor binding on an estrogen response element located on the cyp19a1b promoter (Diotel et al., 2010). These together suggest active production of estrogens and auto-regulation in the brain at the time of ovarian cavity formation. In supporting of this, Nakamura & Nagahama (1985) have noticed the presence of steroid producing cells at the beginning of ovarian cavity formation in a fish species.

dr-20-4-367-g3
Fig. 3. Expression of estrogen receptor alpha mRNA (esr1) in the brain at different days post-hatch (a) and at different phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM. * indicates significant differrence from the respective previous DPH (P<0.05). Different letters on top of each bar indicate significant differrence (P<0.05).
Download Origianl Figure
3. Hypothalamic gonadotropic changes during the formation of ovarian cavity

gnrh - GnRH mRNA in the brain significantly increased at 70 DPH and remain suppressed until 90 DPH (Fig. 4, P<0.05). Since then, it recovered back to the level before 70 DPH. However, the levels did not show any differences with regard to the formation of ovarian cavity (P>0.05). In fish including red spotted species in this study, the strong expression of gnrh appear to be in favor of testicular differentiation rather than ovarian differentiation. Nile tilapia showed clear differential temporal patterns of GnRH localization and expression between genetic male and genetic female larva (Swapna et al., 2008). In European sea bass, the expression of GnRH gene was signicantly higher in male-dominant population than female-dominant population (Moles et al., 2007). Suppressed expression of gnrh in this study are consistent with these findings, signifying potential hypothalamic influence on the primary sex differentiation in this species.

dr-20-4-367-g4
Fig. 4. Expression of GnRH1 mRNA (gnrh1) in the brain at different days post-hatch (a) and at different phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM. * indicates significant difference from the respective previous DPH (P<0.05). Different letters on top of each bar indicate significant difference (P<0.05).
Download Origianl Figure

gnrhr1 - GnRH-receptor 1 mRNA in the brain was started to be actively expressed from 90 DPH and remained high since then. This increased level seems associated with the formation of ovarian cavity as the level was significantly higher at the phase of completion than the level at the onset (Fig. 5, P<0.05).

dr-20-4-367-g5
Fig. 5. Expression of GnRH receptor 1 mRNA (gnrhr1) in the brain at different days post-hatch (a) and at different phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM.* indicates significant differrence from the respective previous DPH (P<0.05). Different letters on top of each bar indicate significant difference (Pv0.05).
Download Origianl Figure

fsh, lh and cga - These three GtH subunit genes in the brain were started to be actively expressed from 85 (for lh and cga) or 90 DPH (for fsh). Expression of these genes were associated with the formation of ovarian cavity, showing significantly higher levels at the phase of completion (Fig. 6, 7 and 8, P<0.05).

dr-20-4-367-g6
Fig. 6. Expression of FSHβ mRNA (fsh) in the brain at different days post-hatch (a) and at different phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM. * indicates significant difference from the respective previous DPH (P< 0.05). Different letters on top of each bar indicate significant difference (P<0.05).
Download Origianl Figure
dr-20-4-367-g7
Fig. 7. Expression of LHβ mRNA (lh) in the brain at different days post-hatch (a) and at different phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM. * indicates significant difference from the respective previous DPH (P<0.05). Different letters on top of each bar indicate significant difference (P<0.05).
Download Origianl Figure
dr-20-4-367-g8
Fig. 8. Expression of common glycoprotein α mRNA (cga) in the brain at different days post-hatch (a) and at different phases of ovarian cavity formation (three phases: onset, proceed and completion) (b). Each bar represents the mean±SEM. * indicates significant difference from the respective previous DPH (P<0.05). Different letters on top of each bar indicate significant difference (P<0.05).
Download Origianl Figure

GnRH receptor in the pituitary relays hypothalamic signals to gonadotropic cells to induce the production of GtH. Similar expression patterns of gnrhr1, fsh, lh and cga observed in this study is well agreed to this flow of hormonal signals in animals. Expressions of all these genes were closely associated with the formation of ovarian cavity although none of these were initiating factors for the sex differentiation. Baroiller et al. (1999) suggested that the hypothalamic gonadotrophic axis may be needed to complete sex differentiation but not activate it. The hypothalamic gonadotropic influence on fish sex is particularly obvious in hermaphrodite fish. In a protogynous species the bluehead wrasse, Thalassoma bifasciatum, injection of females with human chorionic gonadotropin (hCG) induced in all cases a significant percentage of female-to-male sex inversions, demonstrating that a short rise in gonadotropic secretion will trigger sex inversion without the need for high sustained secretions (Koulish and Kramer, 1989). Red spotted grouper is a protogynous like the bluehead wrasse, and showed siginificant decrease of gnrh and increase of gonadotropic factors such as gnrhr1, fsh, lh and cga during the formation of ovarian cavity, suggesting that the primary sex differentiation of this species might be sensitive to artificial treatment with GnRH or GtH.

In conclusion, highly expressed cyp19a1b in the brain is not likely to be the cause of the ovarian cavity formation since it was low at the onset of the formation. Active production of estrogens and auto-regulation may take place in the brain at the time of ovarian cavity formation in this species. The hypothalamic gonadotropic influence on fish sex seems obvious in hermaphrodite fish. Red spotted grouper is a protogynous, and showed siginificant decrease of gnrh and increase of gonadotropic factors such as gnrhr1, fsh, lh and cga during the formation of ovarian cavity, suggesting that the primary sex differentiation of this species might be sensitive to artificial treatment with GnRH or GtH. Further studies should prove this by means of in vivo experiment.

ACKNOWLEDGEMENTS

This research was supported by the Korean Ministry of Agriculture, Food and Rural Affairs (MAFRA), the Korean Ministry of Oceans and Fisheries (MOF), the Korean Rural Development Administration (RDA), and Korea Forest Service (KFS) (Grant number: 213004-04-04-SB620).

REFERENCES

1.

Baroiller JF, Guiguen Y, Fostier A. Endocrine and environmental aspects of sex differentiation in fish. Cell Mol Life Sci. 1999; 55:910-931.

2.

Dietrich DR, Krieger HO. Histological Analysis of Endocrine Disruptive Effects in Small Laboratory Fish. New Jersey: John Wiley & Sons, Inc. 2009; p. 19-51.

3.

Diotel N, Le Page Y, Mouriec K, Tong SK, Pellegrini E, Vaillant C, Anglade I, Brion F, Pakdel F, Chung BC, Kah O. Aromatase in the brain of teleost fish: expression, regulation and putative functions. Front Neuroendocrinol. 2010; 31:172-192.

4.

Grober MS, Sunobe T. Serial adult sex change involves rapid and reversible changes in forebrain neurochemistry. NeuroReport. 1996; 7:2945-2949.

5.

Goos HJ, Senthilkumaran B, Joy KP. Neuroendocrine integrative mechanisms in the control of gonadotropin secretion in teleosts. Narousa New Delhi 113-136. 1999.

6.

Guiguen Y, Fostier A, Piferre F, Chang C-F. Ovarian aromatase and estrogens: A pivotal role for gonadal sex differentiation and sex change in fish. Gen Comp Endocrinol. 2009; 165:352-366.

7.

Hunter GA, Donaldson EM. Hormonal sex control and its application to fish culture. In: Hoar WS, Randall DJ, Donaldson EM, editors. Fish Physiol. 9B. Academic Press New York. 1983; p. 223-303.

8.

Kobayashi Y, Murata R, Nakamura M. Physiological and endocrinological mechanisms of sex change in the grouper. Nova Biomedical. 2013; 13:221-233.

9.

Kim HK, Kim JH, Kim WS, Baek HJ, Kwon JY. Early gonadal differentiation of the protogynous red spotted grouper, Epinephelus akaara. Dev Reprod. 2015; 19:209-215.

10.

Koulish S, Kramer CR. Human chorionic gonadotropin (hCG) induces gonadal reversal in a protogynous fish, the bluehead wrasse, Thalassoma bifasciatum (Teleostei, Labridae). J Exp Zool. 1989; 252:156-168.

11.

Kwon JY, McAndrew BJ, Penman DJ. Cloning of brain aromatase gene and expression of brain and ovarian aromatase genes during sexual differentiation in genetic male and female Nile tilapia Oreochromis niloticus. Mol Reprod Develop. 2001; 59:359-370.

12.

Kwon JY, Kim J. Differential expression of two distinct aromatase genes (cyp19a1a and cyp19a1b) during vitellogenesis and gestation in the viviparous black rockfish Sebastes schlegelii. Ani Cells Sys. 2013; 17:88-98.

13.

Li GL, Liu XC, Lin HR. Effects of aromatizable and nonaromatizable androgens on the sex inversion of red-spotted grouper (Epinephelus akaara). Fish Physiol Biochem. 2006; 32:25-33.

14.

Li GL, Liu XC, Lin HR. Seasonal changes of serum sex steroids concentration and aromatase activity of gonad and brain in red-spotted grouper (Epinephelus akaara). Ani Reprod Sci. 2007; 99:156-166.

15.

Moles G, Carrillo M, Mananos E, Mylonas CC, Zanuy S. Temporal profile of brain and pituitary GnRHs, GnRH-R and gonadotropin mRNA expression and content during early development in European sea bass (Dicentrachus labrax L). Gen Comp Endocrinol. 2007; 150:75-86.

16.

Nakamura M, Nagahama Y. Steroid producing cells during ovarian differentiation of the tilapia, Sarotherodon niloticus. Dev Growth & Different. 1985; 27:701-708.

17.

Nakamura M, Kobayashi T, Chang XT, Nagahama Y. Gonadal sex differentiation in teleost fish. J Exp Zool. 1998; 281:362-372.

18.

Okumura S. Evidence of sex reversal towards both directions in reared red spotted grouper Epinephelus akaara. Fish Sci. 2001; 67:535-537.

19.

Peter RE, Trudeau VL, Sloley BD. Brain regulation of reproduction in teleosts. Bull Inst Zool Acad Sin. 1991; 16:89-118.

20.

Patil JG, Gunasekera RM. Tissue and sexually dimorphic expression of ovarian and brain aromatase mRNA in the Japanese medaka (Oryzias latipes): implications for their preferential roles in ovarian and neural differentiation and development. Gen Comp Enocrinol. 2008; 158:131-137.

21.

Swapna I, Sudhakumari CC, Sakai F, Sreenivasulu G, Kobayashi T, Kagawa H, Nagahama Y. Seabream GnRH immunoreactivity in brain and pituitary of XX and XY Nile tilapia Oreochromis niloticus during early development. J Exp Zool A. 2008; 309:419-442.

22.

Tanaka H, Hirose K, Nogami K, Hattori K, Ishibashi N. Sexual maturation and sex reversal in red spotted grouper, Epinephelus akaara. Bull Natl Res Inst Aquacult. 1990; 17:1-15.

23.

Vizziano-Cantonnet D, Anglade I, Pellegrini E, Gueguen MM, Fostier A, Guiguen Y, Kah O. Sexual dimorphism in the brain aromatase expression and activity, and in the central expression of other steroidogenic enzymes during the period of sex differentiation in monosex rainbow trout populations. Gen Comp Endocrinol. 2011; 170:346-355.

24.

Yamazaki F. Sex control and manipulation in fish. Aquacult. 1983; 33:329-354.

25.

Zohar Y, Munoz-Cueto JA, Elizur A, Kah O. Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocrinol. 2010; 165:438-455.