Development & Reproduction
Korean Society of Developmental Biology
Research article

Effects of Haematococcus lacustris-Supplemented Diets on the Development of Body Color and Health of Giant Freshwater Prawn (Macrobrachium rosenbergii)

Bo Ryung Park*,https://orcid.org/0009-0004-7751-8585, Sung Jun Lee*https://orcid.org/0009-0009-4030-5603, Jeong Hee Yoonhttps://orcid.org/0009-0009-2391-4474, Ji Eun Hahttps://orcid.org/0009-0003-0901-9875, Dong Woo Kimhttps://orcid.org/0009-0005-4022-2139, Jeong Hee Minhttps://orcid.org/0009-0002-2433-4964, Se Ryun Kwonhttps://orcid.org/0000-0002-4656-2143, Joon Yeong Kwonhttps://orcid.org/0000-0001-8485-0878
Department of Aquatic Life Medical Sciences, Sunmoon University, Asan 31460, Korea

These authors contributed equally to this work.

Corresponding author Bo Ryung Park, Department of Aquatic Life Medical Sciences, Sunmoon University, Asan 31460, Korea. Tel: +82-41-530-2284, E-mail: alallall@sunmoon.ac.kr

Copyright © 2025 The Korean Society of Developmental Biology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creative-commons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Sep 23, 2025 ; Revised: Nov 20, 2025 ; Accepted: Dec 14, 2025

Published Online: Dec 31, 2025

Abstract

The body color of crustaceans is an important factor influencing consumer preference and marketability, expressed through the accumulation of carotenoids within the body. However, crustaceans cannot synthesize carotenoids internally and rely entirely on dietary sourcess. Deficiency of this pigment can lead to poor body coloration. Haematococcus lacustris is a species of freshwater microalgae that accumulates astaxanthin at high concentrations, possessing significant industrial potential as a natural source of carotenoids. This study investigated the effects of adding H. lacustris, which is rich in astaxanthin, to feed on improving body color and health status in Macrobrachium rosenbergii post-larvae. The experimental results showed that body length exhibited similar growth trends across all groups, while body weight was significantly higher in the control (CON) group compared with the low concentration (LC) and high concentrations (HC) groups. Feed supplemented with H. lacustris exhibited a darkening effect on body color depending on concentration, and this effect persisted even after heating. Superoxide dismutase (SOD) expression levels in the hepatopancreas significantly increased at day 60 in the HC group. Crustin expression also significantly increased in the hepatopancreas on day 60, but no significant differences were observed between groups in the tail muscle. The addition of H. lacustris to the diet aided in the body color development of M. rosenbergii post-larvae, suggesting that this approach may also be applicable to the body color development of various crustaceans.

Keywords: Macrobrachium rosenbergii; Haematococcus lacustris; Carotenoids; Body color; Antioxidant; Antimicrobial peptides

INTRODUCTION

The giant freshwater prawn (Macrobrachium rosenbergii) is a major freshwater aquaculture species widely farmed in tropical and subtropical regions (New, 2005). According to the Food and Agriculture Organization of the United Nations (FAO), global aquaculture production of M. rosenbergii exceeded 312,000 tons in 2020 (FAO, 2024), highlighting its substantial economic importance in the aquaculture industry. Consumers generally prefer organisms with vivid and intense coloration, which in crustaceans is produced through the accumulation of carotenoids (Latscha, 1989). However, crustaceans are unable to synthesize carotenoids endogenously and therefore depend entirely on dietary sources (Goodwin, 1952). As a result, insufficient carotenoid intake can lead to poor coloration, reduced marketability, and increased physiological stress (Wade et al., 2015; Long et al., 2017).

Carotenoids are terpenoid pigments widely distributed in nature and are synthesized by plants, algae, and certain microorganisms. They typically appear in shades of red, orange, and yellow (Lu & Li, 2008). Structurally, carotenoids are classified into carotenes and xanthophylls. Carotenes, such as β-carotene and lycopene, lack oxygen in their structure, whereas xanthophylls include astaxanthin, lutein, and zeaxanthin, contain oxygen (Jackson et al., 2008). Carotenoids contribute to growth, immunity, and survival through various physiological activities that extend beyond their role as pigments (Choi & Kim, 2022). In particular, they possess strong antioxidant properties, protecting cellular structures from reactive oxygen species (ROS) and enhancing immune cell function (Jackson et al., 2008). In crustaceans, dietary carotenoids accumulate primarily in the hepatopancreas, ovaries, epidermis, and carapace, where they generate diverse coloration patterns that directly influence the intensity of body color (Li et al., 2020).

Unlike vertebrates, the invertebrate M. rosenbergii lacks an adaptive immune system and depends on innate immune responses to defend against external pathogens (Tassanakajon et al., 2015; Zhao et al., 2022). Antimicrobial peptides (AMPs) are components of the humoral immune system and play essential roles in protecting the organism from invading pathogens. Crustin is one of the numerous AMPs identified in crustaceans. The first crustin was reported in the Carcinus maenas and was named carcinin (Schnapp et al., 1996). Crustin is primarily expressed in circulating hemocytes within the hemolymph system (Tassanakajon et al., 2015) and has been shown to exhibit antimicrobial activity against Gram-positive bacteria (Matos & Rosa, 2022). Upon pathogen infection, crustin expression increases and contributes to pathogen elimination through enhanced phagocytosis and the regulation of immune-related genes (Zhao et al., 2022).

Furthermore, the health status of shrimp is closely associated with the maintenance of oxidative homeostasis within their bodies. Stress factors common in aquaculture environments, including high-density farming, fluctuations in water quality, and pathogen invasion, can trigger excessive accumulation of ROS. This accumulation leads to lipid peroxidation of cell membranes, protein denaturation, and DNA damage, which severely compromise cellular function (Chew & Park, 2004; Nath & Haldar, 2020). Superoxide dismutase (SOD), one of the primary antioxidant enzymes responsible for ROS removal, converts the superoxide radical (O₂⁻), a type of ROS, into the relatively less harmful hydrogen peroxide (H₂O₂) and oxygen (O₂) (Chew & Park, 2004). Therefore, the function of the antioxidant defense system, including SOD activity, is considered a key factor in maintaining shrimp health and enhancing their immune capacity (Nath & Haldar, 2020).

Several studies have reported that supplementing carotenoids in feed has beneficial effects not only on improving the body color of crustaceans but also on enhancing antioxidant activity, immune function, and survival rates. Research using Forsythia koreana leaves in the diet of M. rosenbergii (Kim et al., 2023) and mangrove leaves for Penaeus monodon (Alam et al., 2022) has demonstrated that terrestrial plants can improve body coloration. However, terrestrial plants collected from nature environments pose risks of contamination and pathogen exposure, and their slow growth rates make large-scale production within a short period challenging. Therefore, there is a need to identify stable and efficient plant-based sources of carotenoids that can address these limitations.

The microalgae Haematococcus lacustris is gaining attention as an alternative capable of overcoming these limitations. H. lacustris is a single-celled freshwater microalgae that contains large amounts of astaxanthin, a carotenoid pigment (Boussiba, 2000). As a survival strategy under environmental stress conditions such as high light intensity, nutrient deficiency, and salinity changes, it biosynthesizes astaxanthin in large quantities and can accumulate it up to 3%–5% of its dry weight (Khoo et al., 2019; Bas et al., 2021), which makes it highly valuable for industrial use. It can also be mass-cultured under controlled conditions and has a doubling time of approximately 5 days (Sipaúba-Tavares et al., 2023), allowing stable production within a short period. Astaxanthin is regarded as a particularly effective supplement because of its strong antioxidant capacity and its ability to enhance pigmentation (Chien & Jeng, 1992; Long et al., 2017). It is known to prevent cellular damage through its potent suppression of oxidative stress and to contribute to maintaining the physiological adaptability of crustaceans (Wu et al., 2017).

Therefore, in this study, a 60-day feeding trial was conducted to evaluate the effects of H. lacustris supplemented diet on the growth, body color enhancement, expressions of SOD and crustin genes, and also on the histological changes of the hepatopancreas in M. rosenbergii post-larvae.

MATERIALS AND METHODS

1. Preparation of experimental diet

Experimental diet was prepared by adding freeze-dried H. lacustris powder (astaxanthin content: 3% w/w) to commercial feed (Daeha Plus Start, Woosung Feed, Daejeon, Korea) (Table 1). Three experimental diets were formulated based on the astaxanthin content: control (CON, 0 mg/kg diet), low concentration (LC, 50 mg/kg diet), and high concentration (HC, 200 mg/kg diet). The dietary astaxanthin levels were determined based on previous studies conducted in Lipopenaeus vannamei (Niu et al., 2009) and Marsupenaeus japonicus (Chien & Shiau, 2005). To achieve the experimental astaxanthin levels, 1.66 g/kg and 6.64 g/kg of H. lacustris powder was added to LC and HC, respectively (Table 2).

Table 1. Composition and ingredients of the commercial shrimp powder feed used in all experimental diets
Ingredients %
 Animal protein (fish meal, fish juice adsorption feed) 69.0
 Grain (wheat) 16.0
 Plant-based proteins (soybean meal, corn gluten) 8.0
 Supplemental feed ingredients (vitamin C·E, choline chloride, monocalcium phosphate) 5.0
 Fish oil 2.0
Proximate analysis (% of DM basis)
 Crude protein 52.0
 Crude lipid 8.0
 Crude fiber 3.0
 Crude ash 17.0
 Calcium 1.0
 Phosphorus 2.7
 Moisture 14.0

DM, dry matter.

Download Excel Table
Table 2. Experimental diets supplemented with Haematococcus lacustris powder for Macrobrachium rosenbergii</b>
Groups Feed type
Control (CON) Freeze-dried powder of H. lacustris/feed (0 g/kg) Astaxanthin/feed (0 mg/kg)
Low concentration (LC) Freeze-dried powder of H. lacustris/feed (1.66 g/kg) Astaxanthin/feed (50 mg/kg)
High concentration (HC) Freeze-dried powder of H. lacustris/feed (6.64 g/kg) Astaxanthin/feed (200 mg/kg)
Download Excel Table
2. Experimental prawns and rearing conditions

M. rosenbergii larvae for the experiment were produced by mating adult male and female prawns grown in fish rearing facility at Sunmoon University. The larvae were accommodated into nine tanks (180 L, each) at a rate of 120 individuals per tank. PVC corrugated sheets (Plavenia) were placed over the tanks to prevent the prawn from escaping. Sizes of prawn larvae were 19.8±0.8 mg (weight) and 1.08±0.20 cm (total length) at the beginning of the experiment. The experimental diets were provided twice a day at 9:00 AM and 6:00 PM. Fifty percent of the rearing water was replaced daily, and the water temperature was maintained at 28±1°C throughout the 60-day rearing experiment.

Before placing them in the experimental tanks, 40 prawns were randomly collected. Among these, 30 were weighed and measured for total length, and their hepatopancreas and tail muscle tissues were collected for genetic analysis and stored at −80°C. The remaining 10 were photographed for body color analysis.

3. Survival rate and growth rate

On days 30 and 60 of rearing, five prawns were randomly collected from each tank to measure growth, and their weight and total length were recorded. After measurement, the hepatopancreas and tail muscle were collected and stored at −80°C for gene expression analysis. Survival rate was calculated by counting the number of prawns remaining in each tank at the end of the experiment.

4. Body color change

To analyze body color changes at 30 and 60 days of cultivation, ten prawns were randomly collected from each tank and photographed. Photography was conducted from the side after placing each prawn in a transparent acrylic tank. The camera settings were fixed at ISO 50, shutter speed 1/500 s, and white balance 3,500 K. Lighting (Panasonic LED Smart Stand, Panasonic, Osaka, Japan) was used inside a darkroom to maintain consistent lighting conditions. The captured images were quantitatively analyzed using Adobe Photoshop software by measuring the R (red), G (green), and B (blue) values in the striped area at the base of the eye stalk, where coloration first appears.

At the end of the experiment, ten prawns were randomly selected from each tank to observe body color changes after heating and stored at −20°C. Subsequently, they were then heated in boiling water at 100°C for 3 minutes, after which the body color was observed.

5. RNA extraction and gene expression analysis

Gene expression was analyzed using hepatopancreas and tail muscle tissues stored at −80°C. Total RNA was extracted using Trizol Reagent (Ambion, Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. The extracted RNA was quantified using a spectrophotometer (NanoDrop 2000, Thermo Scientific, Waltham, MA, USA). cDNA was synthesized using TOPscript RT DryMIX (Enzynomics, Daejeon, Korea), and the remaining RNA was stored at −80°C.

6. Quantitative real-time polymerase chain reaction

The synthesized cDNA was mixed with 10 μL Topreal qPCR 2X PreMIX SYBR Green (Enzynomics, Daejeon, Korea), 1 μL of forward primer, 1 μL of reverse primer, diethylpyrocarbonate (DEPC) (Intron, Seongnam, Korea) 3 μL, and 5 μL of 50-fold diluted cDNA, resulting in a total volume of 20 μL. The primer sequences used in this are listed in Table 3.

Table 3. Primer sequences for quantitative real-time PCR
Gene name Primer sequence (5’-3’) Genbank no.
β-actin F TCCGTAAGGACCTGTATGCC AY651918.2
R TCGGGAGGTGCGATGATTTT
SOD F TCGCCTAACGAGGAGGTTC DQ121374
R CGGCTTCATCAGGATTTTGAG
Crustin F AACGACTTCAAGTGCTTCGGGTCT JQ413342.1
R AAGCTTAGTGGTTTGCAGACGTGC

PCR, polymerase chain reaction; F, forward; R, reverse; SOD, superoxide dismutase.

Download Excel Table

Quantitative real-time polymerase chain reaction (qRT-PCR) conditions were with the following conditions. The reaction began with an initial denaturation (95°C, 15 min), denaturation (95°C, 10 sec), annealing (60°C, 15 sec), elongation (72°C, 20 sec). Reactions were performed for a total of 40 cycles using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). After the reaction, the melting curve was analyzed by relative quantification using the β-actin gene as a control gene.

7. Histological analysis

The hepatopancreas of each individual was collected for histological analysis after body color photography. The tissue was fixed in a 10% neutral formalin solution for 24 hours, then dehydrated, cleared, and embedded in paraffin. To prevent tearing during sectioning, the paraffin block was immersed in a mixture of 60% alcohol and glycerol in a 1 to 9 ratio for 24 hours to soften the tissue. Sections with a thickness of 5 μm were prepared using a microtome. After being dried for 24 hours, the sections were stained with hematoxylin and eosin and examined under an optical microscope to assess tissue condition.

8. Statistical analysis

All data are expressed as the mean±SEM. Survival rate, growth performance, body color, and gene expression levels were analyzed using one-way ANOVA (GraphPad Software, San Diego, CA, USA). When significant differences between experimental groups were analyzed using Duncan’s test and SPSS Statistics 20 (p<0.05).

RESULTS

1. Survival rate and growth results

The survival rate and growth performance of M. rosenbergii fed diets supplemented with H. lacustris for 60 days are shown in Figs. 1 and 2. No significant differences in survival rate were observed among the groups (p>0.05) (Fig. 1). In contrast, growth performance, assessed by body weight and total length, showed significant differences between the H. lacustris-supplemented groups and the control (p<0.05). However, the magnitude of these growth differences was relatively small (Fig. 2).

dr-29-4-161-g1
Fig. 1. Survival rates of Macrobrachium rosenbergii fed diets supplemented with Haematococcus lacustirs. Con, control; LC, low concentration; HC, high concentration.
Download Original Figure
dr-29-4-161-g2
Fig. 2. Changes in body weight (A) and length (B) of Macrobrachium rosenbergii fed diets supplemented with Haematococcus lacustirs. Different letters indicate significant differences between dietary treatment groups at the same time point (p<0.05). Con, control; LC, low concentration; HC, high concentration.
Download Original Figure
2. Body color change

Analysis of body color using RGB values revealed that at 30 days, no significant differences were found between groups in the Green and Blue values, but HC showed significantly higher Red values compared to CON and LC groups. At 60 days, HC exhibited significantly lower Red and Green compared to CON and LC, while Blue values showed significant differences among all treatment groups (Fig. 3).

dr-29-4-161-g3
Fig. 3. RGB values representing color changes in Macrobrachium rosenbergii fed diets supplemented with Haematococcus lacustirs (n=30 / group). (A) Red, (B) Green, (C) Blue. Different letters indicate significant differences between dietary treatment groups at the same time point (p<0.05). Con, control; LC, low concentration; HC, high concentration.
Download Original Figure

After heating in boiling water, the carapace and tail muscle of the CON turned a milky white, whereas prawns fed diets supplemented with H. lacustris developed a red coloration that increased in intensity with higher inclusion (Fig. 4).

dr-29-4-161-g4
Fig. 4. Color differences between dietary groups after boiling at 100°C for 3 minutes. Con, control; LC, low concentration; HC, high concentration.
Download Original Figure
3. Changes in antioxidant and immune gene expression

Analysis of SOD gene expression revealed no significant differences between groups on days 1 and 30. However, on day 60, expression levels in the HC group were significantly higher than those in the CON and LC groups (Fig. 5).

dr-29-4-161-g5
Fig. 5. Superoxide dismutase (SOD) gene expression in the hepatopancreas of Macrobrachium rosenbergii fed diets supplemented with H. lacustris (n=15 / group). Different letters indicate significant differences between dietary treatment groups at the same time point (p<0.05). Con, control; LC, low concentration; HC, high concentration.
Download Original Figure

Crustin gene expression showed no significant differences among groups on days 1 and 30. However, by day 60, expression levels in HC group were significantly higher than those in the CON and LC groups. In the tail muscle, crustin expression showed no significant differences among all experimental groups throughout the entire period (Fig. 6).

dr-29-4-161-g6
Fig. 6. Crustin gene expression in the hepatopancreas and tail muscle of Macrobrachium rosenbergii fed diets supplemented with H. lacustris (n=15 / group). Different letters indicate significant differences between dietary treatment groups at the same time point (p<0.05). Con, control; LC, low concentration; HC, high concentration.
Download Original Figure
4. Histological structure of the hepatopancreas

The hepatopancreas of all experimental groups maintained a nearly circular cross-sectional structure of the ducts. A marked increase in the number of R cells was observed in the H. lacustris treatment group, and in HC, granules within the R cells were notably more developed. In addition to the R cells, M cells also increased in number in proportion to the H. lacustris supplementation level (Figs. 7 and 8).

dr-29-4-161-g7
Fig. 7. Histological structure of hepatopancreas in Macrobrachium rosenbergii after 60 days of dietary treatments. (A,B)=control; (C,D)=low concentration; (E,F)=high concentration. (A,C,E)=H&E stain at 200×, scale bar=100 μm; (B,D,F)=H&E stain at 400×, scale bar=100 μm. LU (lumen); B (B cell, blister); F (F cell, fibrillar); R (R cell, reabsorption); M (M cell, midget).
Download Original Figure
dr-29-4-161-g8
Fig. 8. Number of hepatopancreas cells (A) M cells and (B) R cells. Different letters indicate significant differences between dietary treatment groups at the same time point (p<0.05). Con, control; LC, low concentration; HC, high concentration.
Download Original Figure

DISCUSSION

1. Growth changes induced by H. lacustris consumption

In this study, after feeding a diet supplemented with H. lacustris for 60 days, no significant differences were observed in the body weight to total length of M. rosenbergii. This finding is consistent with previous studies on L. vannamei fed H. lacustris (Xie et al., 2018) and on M. japonicus fed astaxanthin (Chien & Shiau, 2005), suggesting that supplementation with H. lacustris does not inhibit growth in M. rosenbergii. However, growth response may differ depending on the species, size, and developmental stage of the organisms, as well as the purification and processing methods used for H. lacustris (Wade et al., 2017; Xie et al., 2018).

2. Body color change due to ingestion of H. lacustris

The body color of crustaceans is a key quality indicator that strongly influences consumer purchasing decisions. In general, more vivid and intense coloration is associated with higher market value (Latscha, 1989). The low RGB values observed in the HC group in this study indicate deeper and more saturated coloration, demonstrating that the H. lacustris-supplemented diet effectively enhances the marketability of M. rosenbergii. This effect was particularly prominent at day 60, which is consistent with previous findings that astaxanthin accumulates gradually in the body over time and eventually influences pigmentation (Ju et al., 2011).

Crustaceans cannot synthesize carotenoids endogenously and must obtain them through their diet (Goodwin, 1952). Once ingested, carotenoids are metabolically transformed and used either for pigmentation or for various physiological functions. Because of these physiological characteristics, supplying H. lacustris as a carotenoid source is essential for pigment deposition and body color expression. Numerous studies have reported that astaxanthin has the strongest pigmentation effect among various carotenoids (Yamada et al., 1990; Chien & Jeng, 1992; Niu et al., 2012), which is consistent with the concentration-dependent enhancement observed in this study. In addition, the vivid red coloration that remained in the HC group even after heating indicates the thermal stability of astaxanthin (Parisenti et al., 2011). This suggests that the quality of pigmentation can be maintained during actual consumption and cooking processes.

3. Antioxidant and immune gene expression according to H. lacustris content

SOD is a major antioxidant enzyme that eliminates ROS and plays an essential role in protecting tissues from cellular damage caused by oxidative stress and phagocytosis (Chien et al., 2003; Kim et al., 2019; Mansour et al., 2022). In this study, SOD gene expression in the hepatopancreas showed a decreasing trend on day 30, although the difference was not statistically significant. At day 60, expression levels were significantly higher in the HC group, suggesting that H. lacustris did not induce a positive antioxidant response. Similar results were observed in M. rosenbergii (Li et al., 2025) and Takifugu rubripes (Ou et al., 2019) when astaxanthin was supplied. when astaxanthin was provided. However, studies adding astaxanthin to L. vannamei (Zhang et al., 2013) and on H. lacustris supplementation (Fang et al., 2022) reported that astaxanthin-fed groups exhibited lower antioxidant gene expression than the controls, indicating that the optimal astaxanthin concentration may vary depending on species characteristics (Liao et al., 2018) also found that antioxidant enzyme activity in T. rubripes was significantly reduced at low astaxanthin concentrations, while no significant effect was observed at a high concentration of 500 mg/kg, suggesting that excessive intake may cause adverse effects.

Crustin is an immune-related peptide with antimicrobial activity in crustaceans (Smith et al., 2008), and its expression levels in the hepatopancreas also showed a significant increase. On day 60, HC showed significantly higher expression levels compared to CON and LC, suggesting that H. lacustris consumption induces immune gene expression. In contrast, no significant changes were observed in CON and LC, indicating that the effect occurred only at HC. No significant changes in crustin expression were detected in the tail muscle. This suggests that the tail muscle may be less sensitive to immune responses than the hepatopancreas, or that there may be tissue-specific differences in responsiveness to astaxanthin. Meanwhile, a study feeding Arthrospira platensis extract to L. vannamei (Mansour et al., 2022) reported a significant increase in crustin expression in the tail muscle as well, demonstrating that patterns of immune gene expression vary by tissue depending on experimental conditions.

4. Histological structure of the hepatopancreas according to H. lacustris content

The hepatopancreas integrates the functions of the pancreas, intestines, and liver to synthesize and secrete digestive enzymes, absorbing digested substances, and store nutrients (Caceci et al., 1988; NRC, 2011). It is composed of numerous hepatopancreatic tubules, each lined by a single layer of epithelial cells that include blister (B), fibrillary (F), reabsorption (R), embryonic (E), and midget (M) cell types (Franceschini-Vicentini et al., 2009). At the center of each villus lies the lumen, which serves as the passageway for the secretion of digestive enzymes and the transport of digested materials. Each cell type performs a distinct role, with E cells responsible for epithelial regeneration, F cells producing digestive enzymes and facilitating extracellular digestion, R cells storing lipids and glycogen, B cells carrying out intracellular digestion and nutrient absorption, and M cells involved in nutrient storage and endocrine regulation (Silva et al., 2018; Ruiz et al., 2020).

Histological analysis revealed that in all experimental groups, the hepatopancreas maintained structurally normal circular tubules and central lumens, with no evidence of tissue damage or pathological degeneration. However, clear differences were observed in cellular composition. While the distribution of B cells remained similar across all groups, HC showed significantly higher numbers of R cells compared to CON and LC, and these R cells contained numerous small vacuoles. R cells are known as the primary nutrient storage cells of the hepatopancreas (Vogt, 1994), and the findings of this study suggest that high-dose astaxanthin intake may have activated R cell function and increased their abundance (Wang et al., 2016). Lipid-soluble granules were particularly abundant in R cells in HC, suggesting that the high intake of astaxanthin, a lipid-soluble compound, may have increased both the number of R cells and intracellular lipid granule accumulation.

M cells also showed a similar increase in number. M cells are small cells located at the base of hepatopancreatic ducts (Ruiz et al., 2020). Positioned close to the duct’s basal region, they are small in size and do not extend into the duct lumen (Silva et al., 2018). In this study, the HC group exhibited an increase in the number of M cells. This is presumed to be due to the need to store large amounts of astaxanthin during digestion after ingesting high concentrations of H. lacustris, which may have increased the number of M cells responsible for nutrient storage.

CONCLUSION

This study investigated the effects of feed supplemented with the microalga H. lacustris on the growth performance, body coloration, and health status of M. rosenbergii. Over the 60 day rearing period, no significant difference in growth rate was detected among the treatments. A higher inclusion level of H. lacustris resulted in more pronounced body coloration, which is likely attributable to increased astaxanthin deposition in the tissues. The treatment also enhanced immune capacity by elevating crustin gene expression in the hepatopancreas. These findings altogether indicate that the addition of H. lacustris could help the body color development of M. rosenbergii post-larvae, suggesting that this approach may also be applicable to the body color development of various crustaceans.

Conflict of interests

The authors declare no potential conflict of interest.

Acknowledgements

This research was supported by‘regional innovation mega project’ program through the Korea Innovation Foundation funded by Ministry of Science and ICT (Project Number: 2023-DD-UP-0007).

Authors’ contributions

Conceptualization: Park BR, Kim DW, Kwon JY.

Data curation: Park BR, Yoon JH.

Formal analysis: Park BR, Ha JE.

Methodology: Park BR, Min JH.

Software: Park BR, Lee SJ, Kwon SR.

Validation: Park BR, Kwon JY.

Investigation: Park BR.

Writing-original draft: Park BR.

Writing-review & editing: Park BR, Lee SJ, Yoon JH, Ha JE, Kim DW, Min JH, Kwon SR, Kwon JY.

Ethics approval

This study was approved by the Ethics Committee of Sunmoon University (approval number: SM-2025-10-07).

REFERENCES

1.

Alam MI, Yeasmin S, Khatun MM, Rahman MM, Ahmed MU, Debrot AO, Ahsan MN, Verdegem MCJ. 2022; Effect of mangrove leaf litter on shrimp (Penaeus monodon, Fabricius, 1798) growth and color. Aquacult Rep. 25:101185

2.

Bas TG, Rengel J, Contreras A, Oliu CA, Abarca A. 2021; Determinants of astaxanthin industrial-scale production under stress caused by light photoperiod management of Haematococcus pluvialis cultivation. Lat Am J Aquat Res. 49:725-738

3.

Boussiba S. 2000; Carotenogenesis in the green alga Haematococcus pluvialis: Cellular physiology and stress response. Physiol Plant. 108:111-117

4.

Caceci T, Neck KF, Lewis DDH, Sis RF. 1988; Ultrastructure of the hepatopancreas of the pacific white shrimp, Penaeus vannamei (Crustacea: Decapoda). J Mar Biol Assoc U K. 68:323-337

5.

Chew BP, Park JS. 2004; Carotenoid action on the immune response. J Nutr. 134:257S-261S

6.

Chien YH, Jeng SC. 1992; Pigmentation of kuruma prawn, Penaeus japonicus Bate, by various pigment sources and levels and feeding regimes. Aquaculture. 102:333-346

7.

Chien YH, Pan CH, Hunter B. 2003; The resistance to physical stresses by Penaeus monodon juveniles fed diets supplemented with astaxanthin. Aquaculture. 216:177-191

8.

Chien YH, Shiau WC. 2005; The effects of dietary supplementation of algae and synthetic astaxanthin on body astaxanthin, survival, growth, and low dissolved oxygen stress resistance of kuruma prawn, Marsupenaeus japonicus Bate. J Exp Mar Biol Ecol. 318:201-211

9.

Choi SS, Kim GD. 2022; Production of carotenoids by bacteria; carotenoid productivity and availability. J Life Sci. 32:411-419.

10.

Fang H, Zhuang Z, Huang L, Niu J, Zhao W. 2022; A newly isolated strain of Haematococcus pluvialis GXU-A23 improves the growth performance, antioxidant and anti-inflammatory status, metabolic capacity and mid-intestine morphology of juvenile Litopenaeus vannamei. Front Physiol. 13:882091

11.

Food and Agriculture Organization of the United Nations (FAO) 2024 FAO Fishery and Aquaculture Division. Rome, Italy: FAO. .

12.

Franceschini-Vicentini IB, Ribeiro K, Papa LP, Marques J, , Vicentini CA, Valenti PMCM. 2009; Histoarquitectura del hepatopáncreas del Camarón de la Amazonia macrobrachium amazonicum. Int J Morphol. 27:121-128

13.

Goodwin TW. 1952 The Comparative Biochemistry of the Carotenoids. London, UK: Chapman & Hall. .

14.

Jackson H, Braun CL, Ernst H. 2008; The chemistry of novel xanthophyll carotenoids. Am J Cardiol. 101:50D-57D

15.

Ju ZY, Deng DF, Dominy WG. 2011; Pigmentation of Pacific white shrimp, Litopenaeus vannamei, by dietary astaxanthin extracted from Haematococcus pluvialis. J World Aquacult Soc. 42:633-644

16.

Khoo KS, Lee SY, Ooi CW, Fu X, Miao X, Ling TC, Show PL. 2019; Recent advances in biorefinery of astaxanthin from Haematococcus pluvialis. Bioresour Technol. 288:121606

17.

Kim DW, Yoon JH, Ha JE, Min JH, Park BR, Kwon JY. 2023; Effects of Korean goldenbell (Forsythia koreana) leaf on the growth, body color and hepatopancreatic structure of giant freshwater prawn (Macrobrachium rosenbergii). J Mar Life Sci. 8:166-177.

18.

Kim SH, Lim JW, Kim H. 2019; Astaxanthin prevents decreases in superoxide dismutase 2 level and superoxide dismutase activity in Helicobacter pylori-infected gastric epithelial cells. J Cancer Prev. 24:54-58

19.

Latscha T. 1989 The role of astaxanthin in shrimp pigmentation. In: Advances in Tropical Aquaculture, Workshop at Tahiti, French Polynesia. .

20.

Li H, Yu L, Wei J, Liufu B, Su Q, Hong K, Zhou Q, Zhu H, Wang Y. 2025; Effects of dietary astaxanthin on growth, coloration, immunity, and antioxidant capacity in Macrobrachium rosenbergii. Aquacult Nutr. 2025:8865839

21.

Li Q, Zu L, Cheng Y, Wade NM, Liu J, Wu X. 2020; Carapace color affects carotenoid composition and nutritional quality of the Chinese mitten crab, Eriocheir sinensis. LWT-Food Sci Technol. 126:109286

22.

Liao Z, Xu H, Wei Y, Zhang Q, Liang M. 2018; Dietary astaxanthin differentially affected the lipid accumulation in the liver and muscle of the marine teleost, tiger puffer Takifugu rubripes. Aquacult Res. 49:3421-3433

23.

Long X, Wu X, Zhao L, Liu J, Cheng Y. 2017; Effects of dietary supplementation with Haematococcus pluvialis cell powder on coloration, ovarian development and antioxidation capacity of adult female Chinese mitten crab, Eriocheir sinensis. Aquaculture. 473:545-553

24.

Lu S, Li L. 2008; Carotenoid metabolism: Biosynthesis, regulation, and beyond. J Integr Plant Biol. 50:778-785

25.

Mansour AT, Ashour M, Abbas EM, Alsaqufi AS, Kelany MS, El-Sawy MA, Sharawy ZZ. 2022; Growth performance, immune-related and antioxidant genes expression, and gut bacterial abundance of Pacific white leg shrimp, Litopenaeus vannamei, dietary supplemented with natural astaxanthin. Front Physiol. 13:874172

26.

Matos GM, Rosa RD. 2022; On the silver jubilee of crustacean antimicrobial peptides. Rev Aquacult. 14:594-612

27.

Nath S, Haldar C. 2020; Effects of stress among shrimp post-larvae stocked at high stocking density in nursery culture system: A review. Int J Curr Microbiol Appl Sci. 9:2987-2996

28.

National Research Council (NRC) 2011 Nutrient Requirements of Fish and Shrimp. Washington, DC: The National Academies Press. .

29.

New MB. 2005; Freshwater prawn farming: Global status, recent research and a glance at the future. Aquacult Res. 36:210-230

30.

Niu J, Li CH, Liu YJ, Tian LX, Chen X, Huang Z, Lin HZ. 2012; Dietary values of astaxanthin and canthaxanthin in Penaeus monodon in the presence and absence of cholesterol supplementation: Effect on growth, nutrient digestibility and tissue carotenoid composition. Br J Nutr. 108:80-91

31.

Niu J, Tian LX, Liu YJ, Yang HJ, Ye CX, Gao W, Mai KS. 2009; Effect of dietary astaxanthin on growth, survival, and stress tolerance of postlarval shrimp, Litopenaeus vannamei. J World Aquacult Soc. 40:795-802

32.

Ou W, Liao Z, Yu G, Xu H, Liang M, Mai K, Zhang Y. 2019; The effects of dietary astaxanthin on intestinal health of juvenile tiger puffer Takifugu rubripes in terms of antioxidative status, inflammatory response and microbiota. Aquacult Nutr. 25:466-476

33.

Parisenti J, Beirão LH, Maraschin M, Mouriño J, Do Nascimento Vieira F, Bedin LH, Rodrigues E. 2011; Pigmentation and carotenoid content of shrimp fed with Haematococcus pluvialis and soy lecithin. Aquacult Nutr. 17:e530-e535

34.

Ruiz TFR, Vidal MR, Ribeiro K, Vicentini CA, Vicentini IBF. 2020; Histology of the hepatopancreas and anterior intestine in the freshwater prawn Macrobrachium carcinus (Crustacea, Decapoda). Nauplius. 28:e2020023

35.

Schnapp D, Kemp GD, Smith VJ. 1996; Purification and characterization of a proline-rich antibacterial peptide, with sequence similarity to bactenecin-7, from the haemocytes of the shore crab, Carcinus maenas. Eur J Biochem. 240:532-539

36.

Silva MAS, Almeida Neto ME, Ramiro BO, Santos ITF, Guerra RR. 2018; Histomorphologic characterization of the hepatopancreas of freshwater prawn Macrobrachium rosenbergii (De Man, 1879). Arq Bras Med Vet Zootec. 70:1539-1546

37.

Sipaúba-Tavares LH, Tedesque MG, Fenerick DC, Millan RN, Scardoeli-Truzzi B. 2023; Effect of light/dark cycles on the growth of Haematococcus pluvialis in mixotrophic cultivation with alternative culture media. Biotechnol Res Innov. 6:e2022202

38.

Smith VJ, Fernandes JMO, Kemp GD, Hauton C. 2008; Crustins: Enigmatic WAP domain-containing antibacterial proteins from crustaceans. Dev Comp Immunol. 32:758-772

39.

Tassanakajon A, Somboonwiwat K, Amparyup P. 2015; Sequence diversity and evolution of antimicrobial peptides in invertebrates. Dev Comp Immunol. 48:324-341

40.

Vogt G. 1994; Life-cycle and functional cytology of the hepatopancreatic cells of Astacus astacus (Crustacea, Decapoda). Zoomorphology. 114:83-101

41.

Wade NM, Budd A, Irvin S, Glencross BD. 2015; The combined effects of diet, environment and genetics on pigmentation in the Giant Tiger Prawn. Aquaculture. 449:78-86

42.

Wade NM, Cheers S, Bourne N, Irvin S, Blyth D, Glencross BD. 2017; Dietary astaxanthin levels affect colour, growth, carotenoid digestibility and the accumulation of specific carotenoid esters in the Giant Tiger Shrimp, Penaeus monodon. Aquacult Res. 48:395-406

43.

Wang X, Li E, Xu C, Qin JG, Wang S, Chen X, Cai Y, Chen K, Gan L, Yu N, Du ZY, Chen L. 2016; Growth, body composition, ammonia tolerance and hepatopancreas histology of white shrimp l Litopenaeus vannamei fed diets containing different carbohydrate sources at low salinity. Aquacult Res. 47:1932-1943

44.

Wu X, Zhao L, Long X, Liu J, Su F, Cheng Y. 2017; Effects of dietary supplementation of Haematococcus pluvialis powder on gonadal development, coloration and antioxidant capacity of adult male Chinese mitten crab (Eriocheir sinensis). Aquacult Res. 48:5214-5223

45.

Xie S, Fang W, Wei D, Liu Y, Yin P, Niu J, Tian L. 2018; Dietary supplementation of Haematococcus pluvialis improved the immune capacity and low salinity tolerance ability of post-larval white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 80:452-457

46.

Yamada S, Tanaka Y, Sameshima M, Ito Y. 1990; Pigmentation of prawn (Penaeus japonicus) with carotenoids: I. Effect of dietary astaxanthin, β-carotene and canthaxanthin on pigmentation. Aquaculture. 87:323-330

47.

Zhang J, Liu YJ, Tian LX, Yang HJ, Liang GY, Yue YR, Xu DH. 2013; Effects of dietary astaxanthin on growth, antioxidant capacity and gene expression in Pacific white shrimp Litopenaeus vannamei. Aquacult Nutr. 19:917-927

48.

Zhao C, Wen H, Huang S, Weng S, He J. 2022; A novel disease (water bubble disease) of the giant freshwater prawn Macrobrachium rosenbergii caused by Citrobacter freundii: Antibiotic treatment and effects on the antioxidant enzyme activity and immune responses. Antioxidants. 11:1491