Development & Reproduction
Korean Society of Developmental Biology
Short communication

A Pumilio Activity Sensor Reveals Bag-of-Marbles Inhibition of Pum Activity in the Drosophila Ovary

Wijeong Jang1https://orcid.org/0000-0002-3056-4566, Changsoo Kim1,†https://orcid.org/0000-0002-2852-9649
1School of Biological Sciences and Technology, Chonnam National University, Gwangju 61186, Korea
†Corresponding author Changsoo Kim, School of Biological Sciences and Technology, Chonnam National University, Gwangju 61186, Korea Tel: +82-62-530-5201 Fax: +82-31-8020-2886 E-mail: changgk2001@hanmail.net

© Copyright 2023 The Korean Society of Developmental Biology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jan 08, 2023 ; Revised: Feb 23, 2023 ; Accepted: Mar 17, 2023

Published Online: Mar 31, 2023

Abstract

Pumilio (Pum) is an RNA-binding protein and translational repressor important to diverse biological processes. In the Drosophila ovary, Pum is expressed in female germline stem cells (GSCs), wherein it acts as an intrinsic stem cell maintenance factor via repressing target mRNAs that are as yet mostly unknown. Pum recognizes the Pum binding sequence (PBS) in the mRNA 3’UTR through its C-terminus Puf domain. Translational repression is mediated through its N-terminal domain, but the molecular mechanism remains largely unknown. We previously showed that Bag-of-marbles, a critical differentiation-promoting factor of female GSCs, physically interacts with the N-terminus of Pum. We further showed that this interaction is critical to Bam inhibition of Pum repressive action in cultured cells, but the physiological relevance was not addressed. Here we design an in vivo GFP translational reporter bearing the PBS in its 3’UTR and show that GFP expression is reduced in cells wherein Pum is known to be active. Furthermore, we demonstrate in pum mutant ovary that this GFP repression requires Pum, and also that the sensor faithfully monitors Pum activity. Finally, we show that forced expression of Bam inhibits Pum-mediated repression, validating that Bam inhibits Pum activity in vivo.

Keywords: Pumilio; Bam; Stem cells; Translation repression; Drosophila melanogaster

INTRODUCTION

Stem cells possess the unique ability to self-renew in addition to generating differentiated progeny. The Drosophila ovary offers an incisive genetic system that allows for dissection of the molecular mechanism of stem cell self-renewal (Xie & Spradling, 2000). Two female germline stem cells (GSCs) reside at the apical tip of the germarium, a structure located at the anterior tip of the ovariole, and are physically linked through adherent junctions to niche cells, called cap cells (Xie & Spradling, 1998). During self-renewal stem cell division, one stem cell daughter attached to the cap cells remains as a stem cell while the other, which is one cell distant from the cap cells, starts to differentiate due to reduction of niche signals (Xie & Spradling, 2000). It becomes a cystoblast (CB), which undergoes incomplete mitotic cell division four times to produce a cyst composed of 16 germline cells. Ultimately, 15 of those cells differentiate to nurse cells and one becomes an oocyte (Lin & Spradling, 1993).

In addition to signals from the cap cells, maintaining the stemness of GSCs also requires stem-cell-specific intrinsic factors (Parisi & Lin, 1999; Wang & Lin, 2004). The RNA binding and translational repressor Pum is expressed in GSCs and is required for stemness (Parisi & Lin, 1999; Harris et al., 2011). In pum mutant ovary, GSCs lose their stemness and undergo differentiation, depleting the germarium (Lin & Spradling, 1997; Parisi & Lin, 1999). This suggests that Pumilio (Pum)’s role is to block differentiation of stem cells by inhibiting intrinsic differentiation-promoting factors, though the specific factors it targets remain mostly unknown (Szakmary et al., 2005). The C-terminal Puf motif of Pum recognizes the Pum binding sequence (PBS) in the 3’UTR of target mRNAs (Wharton et al., 1998; Edwards et al., 2001; Weidmann et al., 2016; Qiu et al., 2019), while its N-terminal domain mediates translational repression through molecular mechanisms that are as yet poorly understood (Kim et al., 2010; Weidmann & Goldstrohm, 2012; Arvola et al., 2020).

Bag-of-marbles (Bam) is not expressed in GSCs, but is expressed in the 2-, 4-, and 8-cell CBs, wherein Bam promotes differentiation (McKearin & Spradling, 1990; Lavoie et al., 1999). In the bam mutant ovary, GSC daughters fail to undergo differentiation, culminating in population of the germaria with stem-cell-like cells (McKearin & Spradling, 1990). Forced ectopic expression of Bam in GSCs promotes their differentiation (Ohlstein & McKearin, 1997; Ohlstein et al., 2000), raising the hypothesis that Bam might inhibit Pum activities. We previously tested this hypothesis in vitro and found that Bam physically interacts with the N-terminus of Pum (Kim et al., 2010). We further showed that this physical interaction is essential to inhibition of Pum translational repression activity in cultured cells (Kim et al., 2010). In this work, we design a GFP-based translational reporter bearing the PBS in its 3’UTR and show that this translational reporter is a Pum activity sensor that faithfully monitors Pum activity in the germarium. We furthermore use this sensor to show that Bam inhibits Pum activity in vivo in the Drosophila ovary.

MATERIALS AND METHODS

1. Drosophila stocks

All strains were grown at 25°C on standard yeast, cornmeal agar medium. pum1/TM6 and pumMsc/TM6 flies were obtained from Dr. Wharton. hs-bam flies were a gift from Dr. McKearin.

2. Pumilio activity sensor

The Pum activity sensor was constructed by introducing the PBS into the p2035 vector (Brennecke & Cohen, 2003). The PBS, which is present in the nanos response element (NRE) (+97 to +148) of the hunchback 3’UTR, was amplified by PCR (using primers ctagaattattttgttgtccaaaattgtacataagccgaattcc, tcgaggaattcggcttatgtacaattttggacaacaaaataatt) and inserted between the XbaI and XhoI restriction sites of the p2035 vector. The vector construct was then injected into w1118 embryos to produce the Pum activity sensor transgene.

3. Immunohistochemistry

Ovaries were dissected, fixed, and stained as described previously (Ohlstein & McKearin, 1997). In brief, ovaries were treated for 30 min with fixing solution (4% paraformaldehyde, 0.1% Tween 20). After several washes using PBS with 0.1% Tween 20 (PBST), the samples were preabsorbed for one hour with PBST containing 10% normal goat serum, then incubated with the primary antibody overnight at 4°C. After washing with PBST, the ovaries were incubated with the secondary antibody for two hours at room temperature. After again washing with PBST, the samples were mounted in Vectashield (Vector Laboratories, Road Burlingame, CA, USA). Confocal images were taken and processed by a Zeiss LSM510 Microscope. The GFP level in the area at the apical tip of each germarium was quantified by ImageJ (National Institutes of Health, Bethesda, MD, USA) and the data were graphed using Sigma Plot.

4. Antibodies

Mouse monoclonal anti-1B1 antibody (1:20) was purchased from Developmental Studies Hybridoma Bank (Iowa City, IA, USA). Rabbit polyclonal anti-GFP (1:2,000) was obtained from Invitrogen (Carlsbad, CA, USA). Goat anti-mouse and goat anti-rabbit IgG conjugated to Alexa 488 or Alexa 555 (1:200) were purchased from Molecular Probe (Eugene, OR, USA).

RESULTS AND DISCUSSION

2. Pumilio activity sensor

We constructed a translational reporter to monitor translational repressive activity of Pum in vivo (Fig. 1A), henceforth termed the Pum activity sensor. This reporter consists of the tubulin promoter upstream of the GFP coding sequence which has the PBS in its 3’UTR. The PBS (UGUAXAUA) was taken from the NRE of the hunchback 3’UTR (Wharton & Struhl, 1991; Murata & Wharton, 1995; Zamore et al., 1997; Kim et al., 2010). We expected that Pum would bind the PBS in the reporter and repress translation of GFP. If so, GFP would not be expressed in cells with active Pum, but would be expressed in cells lacking Pum activity, thereby enabling the monitoring of Pum activity.

dr-27-1-39-g1
Fig. 1. The Pum activity sensor faithfully monitors Pum activity in the germaria. (A) Schematic drawing of the Pum activity sensor, which consists of the tubulin (tub) promoter upstream of the GFP coding sequence and the Pum binding sequence (PBS) in the 3’UTR. Pum binds the PBS to mediate translational repression. (B) Schematic drawing of the germarium located at the tip of the Drosophila ovary. Two germline stem cells distinguished by the spectrosome (red circle) are located at the apical tip of the germarium. The star denotes an immediate stem cell daughter. Germline cysts containing 2, 4, 8, and 16 germline cells are displayed in green with the fusome (branched spectrosome) shown in red. (C,D) Confocal images of germaria bearing the Pum activity sensor in the wild-type background (C) and pum mutant background (D); images were co-stained with GFP antibody (green) and 1B1 antibody (red). Pum mutant denotes the pum transheterozygous mutant (pum1/pumMsc). Four-day-old flies were used. White dashed lines encircle cells at the apical tips of germaria. Pum, Pumilio; GFP, green fluorescence protein.
Download Original Figure
2. The Pumilio activity sensor faithfully monitors Pumilio activity in the germaria

Two cells located at the apical tip in the germaria of the Drosophila ovary are GSCs that possess a spectrosome (or round fusome) recognizable by 1B1 antibody (Fig. 1B) (Deng & Lin, 1997). Mitotic cell division of the GSCs produces differentiating germline cysts (consisting of two, four, eight, and 16 cells successively) that are recognized by the presence of a branched spectrosome or fusome, which is also detectable with 1B1 antibody (Lin & Spradling, 1995; Deng & Lin, 1997).

We examined whether the Pum activity sensor faithfully monitors Pum activity in the germaria of the ovary. First, transgenic flies harboring the Pum activity sensor were generated. Ovaries from those transgenic flies were dissected and co-stained with GFP and 1B1 antibodies. In wild-type ovary, GFP expression was severely reduced in the GSCs and in immediate daughter cells derived from their mitotic cell division, which is consistent with reports that Pum is active in the GSCs and immediate daughter cells (Fig. 1C). Meanwhile, GFP was strongly expressed in the germline cyst cells, consistent with reports that Pum is not active in those cells.

To further validate the Pum activity sensor, we examined whether the observed repression of GFP expression requires Pum. Ovaries from transheterozygous mutant (pum1/pumMsc) flies (Wharton et al., 1998) were stained with GFP and 1B1 antibodies. GFP was found to be expressed in all cells (Fig. 1D), demonstrating that its repression requires Pum activity. Combined with the above, these findings confirm that the Pum activity sensor faithfully reports Pum activities in the ovary.

3. Ectopic expression of bag-of-marbles inhibits Pumilio activity as detected by the Pumilio activity sensor

We previously showed that Bam inhibits Pum activity in cultured cells (Kim et al., 2010). Here we examined the in vivo relevance of this finding using the Pum activity sensor. To overexpress Bam in all cells including GSCs, we used the hs-bam transgene (Ohlstein & McKearin, 1997), which consists of a heat-shock promoter upstream of the bam coding sequence and enables ubiquitous expression of bam upon a brief heat shock. hs-bam flies also harboring the Pum activity sensor were subjected to a brief heat shock (37°C, two hours with one-hour interval) and their ovaries were dissected and co-stained with GFP and 1B1 antibodies at 1, 2, 6, 15, 24, 30, 42, and 48 h post-heat shock (PHS).

Control (no heat shock) flies exhibited no GFP in the GSCs (Fig. 2A). At 2 h PHS, a slight increase of GFP occurred in GSCs at the anterior tip (Fig. 2B, E). At 24 h PHS, peak GFP expression was observed (Fig. 2C, E, and Table 1). At 48 h PHS, GFP expression was severely reduced (Fig. 2D, E, and Table 1). In short, induction of Bam by a brief heat shock induced gradual increase of GFP in the GSCs, followed by a decrease (Fig. 2E and Table 1). This suggests that a gradual increase of Bam in turn gradually inhibits Pum activity in a temporal manner. It is of note that the gradual increase of GFP, which reflects a gradual decrease of Pum activity, is accompanied by a gradual decrease in the number of GSCs at the apical tip of the germaria, which is consistent with Pum activity being required for stem cell maintenance.

dr-27-1-39-g2
Fig. 2. Brief expression of Bam inhibits Pum activity as monitored by the Pum activity sensor. (A–D) Confocal images of germaria bearing the Pum activity sensor in conjunction with either the hs-gal4 (A) or the hs-bam (B–D) transgene were co-stained with GFP (green) and 1B1 (red) antibodies. Germaria were from three-day-old flies. hs-gal4 denotes heat-shock promoter-gal4 coding sequence. hs-bam denotes heat-shock promoter-bam coding sequence. (A) Germaria with no heat-shock treatment showed severely reduced GFP level in the GSCs. (B–D) Germaria treated with a brief heat-shock showed slight increase of GFP at 2 h post-heat-shock (PHS) (B), high expression of GFP at 24 h PHS (C), and less GFP at 48 h PHS (D). (E) Graphical representation of GFP level at the apical tip and GSC number. GFP level at the apical tip of the germarium (circled areas in Fig. 2A–D) was quantified using ImageJ (NIH); the data are presented in Table 1. GFP, green fluorescence protein; GSCs, germline stem cells.
Download Original Figure
Table 1. Quantification of GFP level and GSC number
PHS (hour) GFP level GSC number n
0 1.0 (+/− 0.14) 2.5 (+/− 0.5) 13
2 1.1 (+/− 0.14) 1.9 (+/− 0.2) 14
4 1.2 (+/− 0.12) 1.6 (+/− 0.5) 12
6 1.4 (+/− 0.15) 0.8 (+/− 0.7) 15
15 1.7 (+/− 0.3) 0.0 (+/− 0.0) 19
24 2.3 (+/− 0.6) 0.0 (+/− 0.0) 12
30 2.4 (+/− 0.5) 0.0 (+/− 0.0) 13
42 1.7 (+/− 0.3) 1.2 (+/− 0.7) 15
48 1.5 (+/− 0.3) 1.3 (+/− 0.5) 11

GFP levels in the area of the GSCs at the apical tips of germaria (circled areas in Fig. 2A–D) were quantified using Image J (NIH).

GFP level was normalized to the observed in the no heat shock control. Spectrosome-containing cells at the apical tips of germaria were counted as GSCs. PHS denotes post-heat shock. n indicates the number of germaria examined.

Data are presented as mean (±SD).

GFP, green fluorescence protein; GSC, germline stem cell; PHS, post-heat shock.

Download Excel Table
4. Conclusions

Here we examine the physiological relevance of previous findings that Bam inhibits Pum activity in cultured cells. We generated an in vivo Pum activity sensor consisting of a translational GFP reporter that harbors the PBS in its 3’UTR. The sensor faithfully reported Pum activity in the GSCs of the Drosophila ovary; namely, GFP expression was severely reduced in the GSCs, which contain active Pum. In addition, we used the sensor to show that ectopically expressed Bam inhibits Pum activity, which was monitored as increased GFP level. Bam physically interacts with the N-terminus of Pum, which mediates translational repression, possibly through interaction with other proteins (Fig. 3A). Our findings suggest that Bam inhibits Pum activity through blocking such interactions (Fig. 3B).

dr-27-1-39-g3
Fig. 3. Bam inhibition of Pum activity in the Drosophila ovary. (A) The N-terminus of Pum mediates translational repression, possibly through interaction with other proteins. (B) Bam physically interacts with the N-terminus of Pum, inhibiting Pum translational repression activity. PBS, Pum binding sequence.
Download Original Figure

Conflict of interests

The authors declare no potential conflict of interest.

Acknowledgements

This research was supported by grants from the National University Development Project 2021-4065/202233410001 (Changsoo Kim) and NRF-2020R1I1A1A01074292 (Wijeong Jang). We thank Dr. Cohen for the GFP translational reporter vector, which was used to make the Pum activity sensor. We are grateful to Dr. McKearin and Dr. Wharton for the flies.

Authors’ contributions

Conceptualization: Jang W, Kim C.

Data curation: Jang W.

Methodology: Jang W.

Writing-original draft: Jang W.

Writing-review & editing: Jang W, Kim C.

Ethics approval

This article does not require IRB/IACUC approval because there are no human and animal participants.

REFERENCES

1.

RM ArvolaCT ChangJP BuytendorpY LevdanskyE ValkovPL FreddolinoAC Goldstrohm 2020; Unique repression domains of Pumilio utilize deadenylation and decapping factors to accelerate destruction of target mRNAs. Nucleic Acids Res. 48:1843-1871

2.

J BrenneckeSM Cohen 2003; Towards a complete description of the microRNA complement of animal genomes. Genome Biol. 4:228

3.

W DengH Lin 1997; Spectrosomes and fusomes anchor mitotic spindles during asymmetric germ cell divisions and facilitate the formation of a polarized microtubule array for oocyte specification in Drosophila. Dev Biol. 189:79-94

4.

TA EdwardsSE PyleRP WhartonAK Aggarwal 2001; Structure of Pumilio reveals similarity between RNA and peptide binding motifs. Cell. 105:281-289

5.

RE HarrisM PargettC SutcliffeD UmulisHL Ashe 2011; Brat promotes stem cell differentiation via control of a bistable switch that restricts BMP signaling. Dev Cell. 20:72-83

6.

JY KimYC LeeC Kim 2010; Direct inhibition of Pumilo activity by Bam and Bgcn in Drosophila germ line stem cell differentiation. J Biol Chem. 285:4741-4746

7.

CA LavoieB OhlsteinDM McKearin 1999; Localization and function of Bam protein require the benign gonial cell neoplasm gene product. Dev Biol. 212:405-413

8.

H LinAC Spradling 1993; Germline stem cell division and egg chamber development in transplanted Drosophila germaria. Dev Biol. 159:140-152

9.

H LinAC Spradling 1995; Fusome asymmetry and oocyte determination in Drosophila. Dev Genet. 16:6-12

10.

H LinAC Spradling 1997; A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development. 124:2463-2476

11.

DM McKearinAC Spradling 1990; Bag-of-marbles: A Drosophila gene required to initiate both male and female gametogenesis. Genes Dev. 4:2242-2251

12.

Y MurataRP Wharton 1995; Binding of pumilio to maternal hunchback mRNA is required for posterior patterning in Drosophila embryos. Cell. 80:747-756

13.

B OhlsteinCA LavoieO VefE GateffDM McKearin 2000; The Drosophila cystoblast differentiation factor, benign gonial cell neoplasm, is related to DExH-box proteins and interacts genetically with bag-of-marbles. Genetics. 155:1809-1819

14.

B OhlsteinD McKearin 1997; Ectopic expression of the Drosophila Bam protein eliminates oogenic germline stem cells. Development. 124:3651-3662

15.

M ParisiH Lin 1999; The Drosophila pumilio gene encodes two functional protein isoforms that play multiple roles in germline development, gonadogenesis, oogenesis and embryogenesis. Genetics. 153:235-250

16.

C QiuRC DutcherDF PorterY AravaM WickensTMT Hall 2019; Distinct RNA-binding modules in a single PUF protein cooperate to determine RNA specificity. Nucleic Acids Res. 47:8770-8784

17.

A SzakmaryDN CoxZ WangH Lin 2005; Regulatory relationship among piwi, pumilio, and bag-of-marbles in Drosophila germline stem cell self-renewal and differentiation. Curr Biol. 15:171-178

18.

Z WangH Lin 2004; Nanos maintains germline stem cell self-renewal by preventing differentiation. Science. 303:2016-2019

19.

CA WeidmannAC Goldstrohm 2012; Drosophila Pumilio protein contains multiple autonomous repression domains that regulate mRNAs independently of Nanos and brain tumor. Mol Cell Biol. 32:527-540

20.

CA WeidmannC QiuRM ArvolaTF LouJ KillingsworthZT CampbellTM Tanaka HallAC Goldstrohm 2016; Drosophila Nanos acts as a molecular clamp that modulates the RNA-binding and repression activities of Pumilio. eLife. 5:e17096

21.

RP WhartonJ SonodaT LeeM PattersonY Murata 1998; The Pumilio RNA-binding domain is also a translational regulator. Mol Cell. 1:863-872

22.

RP WhartonG Struhl 1991; RNA regulatory elements mediate control of Drosophila body pattern by the posterior morphogen nanos. Cell. 67:955-967

23.

T XieAC Spradling 1998; Decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovary. Cell. 94:251-260

24.

T XieAC Spradling 2000; A niche maintaining germ line stem cells in the Drosophila ovary. Science. 290:328-330

25.

PD ZamoreJR WilliamsonR Lehmann 1997; The Pumilio protein binds RNA through a conserved domain that defines a new class of RNA-binding proteins. RNA. 3:1421-1433.