INTRODUCTION
The epididymis plays important roles in male reproduction, including sperm maturation, transport, and storage (Robaire & Hermo, 1988). The epididymis has a tubular structure covered by an epithelial layer, consisting of several cell types (Arrotéia et al., 2012). Except the initial segment at the most proximal region of the epididymal region, the epididymis is divided into three parts, caput (head), corpus (body), and cauda (tail) epididymis, depending on functional, morphological, and molecular biological characteristics (Robaire & Hermo, 1988). The most predominant type of the epithelial cells in the epididymis is principal cells which are columnar shape with stereocilia protruding into the lumen (Robaire & Hermo, 1988). The number of principal cells gradually decreases from the caput to the cauda epididymis (Robaire & Hermo, 1988). However, the epithelial content of narrow cells increases from the caput to the corpus epididymis, while clear cells are relatively equally distributed through the entire epididymis (Arrotéia et al., 2012). It is generally considered that differrent cell types in the epididymis play specific functions on the establishment of unique epididymal microenvironment (Robaire et al., 2006). Thus, it is reasonable to consider that the different ratios of cell population in the epididymal segment would partly contribute into creation of discrete functional epididymal unit.
Exchanges of signaling molecules, ions, and even RNAs through connexin (Cx)-based gap junction between neighboring cells is a type of direct cell-cell communication ways (Goodenough et al., 1996). There are at least 20 Cx isoforms found in mammals (Meşe et al., 2007). The gap junction is composed of a complex of two hemichannels, which each is made of six Cx isoforms (Cyr, 2011). The presence of Cx isoforms in the male reproductive tract has been examined by several researchers, including our recent findings. Expression of Cx transcripts in the reproductive excurrent duct has been detected in the initial segment (Seo et al., 2010) and epididymis (Han & Lee, 2013; Lee, 2013). Even though expressional pattern of each Cx is quite distinguishable from each other isoform during postnatal development, there are nine Cx isoforms expressing throughout the entire epididymis, including Cx26, Cx30.3, Cx31, Cx31.1, Cx32, Cx37, Cx40, Cx43, and Cx45 (Han & Lee, 2013; Lee, 2013). Expression of certain Cx isoform in the epididymis shows the segment-specific patterns (Han & Lee, 2013; Lee, 2013). For example, the highest levels of Cx40 are detected at 45 days of age in the caput epididymis, at early than 45 days of age in the corpus epididymis, and 5 months of age in the cauda epididymis (Han & Lee, 2013; Lee, 2013). It is difficult to generalize expressional patterns of Cx isoforms in the epididymis during postnatal period because expression of each Cx isoform shows a unique pattern in each epididymal segment. Each Cx isoform possesses particular permeability and gating behavior to specific signaling molecules (Bruzzone et al., 1996). Therefore, it is logic to consider that expression of various Cx isoforms at different levels in the epididymal segments would be necessary to communicate different cell types and thus to produce distinct microenvironment within the epididymal part. Even though a few researches show immuno-localization of some Cx isoforms at specific cell types within the epididymis (Cry, 2011), the function of Cx isoforms has not been clearly demonstrated.
Expressional regulation of Cx isoforms in the epididymis has not been extensively examined, in spite of the presence of strong evidence demonstrating expressional modulation of a number of genes in the epididymis by estrogens and androgens. Dubé et al (2012) have showed possible regulation of Cx43 expression in the human cauda epididymis by epidermal growth factor. Our previous researches have demonstrated that exposure to estradiol benzoate (EB) or flutamide (Flu) at the early or weaning postnatal age results in altered expression of several Cx isoforms in the initial segment of the adult rat epididymis (Lee, 2014; 2015). However, scientific research showing hormonal factor(s) giving an influence on Cx expression in the corpus epididymis is very rare. Thus, in accordance with our earlier studies (Lee, 2014; 2015), the present research was attempted to reveal the effect of EB, an estrogenic agonist, or Flu, an antiandrogenic agent, on expression of Cx isoforms in the corpus epididymis. Expressional changes of Cx isoforms in the adult corpus epididymis followed by the subcutaneous expose to these steroidal compounds at 7 days of postnatal age were evaluated by quantitative realtime PCR analyses.
MATERIALS AND METHODS
The EB and Flu were purchased from Tokyo Chemical Industry Co. (Tokyo, Japan). The powder of EB or Flu was dissolved in 100% EtOH at room temperature. The final stock solutions of EB and Flu were prepared with a series of dilution in peanut oil.
A total of five pregnant Spragure Dawley rats were obtained from Samtako (OSan, Korea). Each female rat was individually kept during entire experimental period. Free access to drinking water and food was allowed. Each rat was randomly assigned to one of five experimental groups, including control (peanut oil), low-dose EB treated (EB-L), high-dose EB treated (EB-H), low-dose Flu treated (Flu-L), or high-dose Flu treated (Flu-H) group. Each pregnant rat delivered 5 to 8 male pups, which were treated with EB or Flu at 7 days of postnatal age. Subcutaneous injection of EB or Flu was carried out at the final concentration of 0.015 μg (EB-L) or 1.5 μg (EB-H) per kilogram of body weight (/kg BW) for EB or 500 μg (Flu-L) or 50 mg (Flu-H)/kg BW for Flu. Number of animals for each experiment group are as following; control (n=5), EB-L (n=7), EB-H (n=8), Flu-L (n=7), and Flu-H (n=7). The present study was carried out in accordance with the guide for the care and use of laboratory animals of National Research Council in S. Korea.
The epididymis was collected from the experimental animals at 4 months of age. First, the animals were anesthetized by CO2 stunning in a closed chamber. The testis and epididymis were exposed through a lower abdominal incision. In cold PBS, the epididymis was separated from the testis and further dissected into initial segment, caput epididymis, corpus epididymis, and cauda epididymis. The epididymal parts were washed in fresh cold PBS for a couple of times and frozen in liquid nitrogen.
Total RNA from the corpus epididymis was harvested with 0.5 mL of easy-Blue total RNA extraction solution (iNtRON Biotechm Seongnam, Korea). Tissue was first homogenized in the solution with a polytron homogenizer (Fisher Scientific, Pittsburgh, USA). After then, phenolchloroform extraction protocol was applied to obtain a pellet of total RNA. Total RNA was resuspended in RNasefree dH2O, and purity and concentration of total RNA were determined spectrophotometrically (Eppendorf, New York, USA).
Reverse transcription (RT) reactions to generate the first strand of cDNAs were carried out with oligo-dT primer and ImProm-IITM reverse transcription system (Promega, Madison, USA). One microgram of total RNA was utilized as a template, and RT reactions were performed at 25°C for 5 min, 42°C for 1 hr and 30 min, and 70°C for 15 min.
One microliter of 20 μL RT reaction mixtures was used to carry out real-time PCR. The PCR cocktail included 10 pmol of primer set, 10 μL of master mixture (Finnzymes, Espoo, Finland), and DNase-free water to make a final volume of 20 μL. The CFX96TM real-time PCR detection system (Bio-rad, Hercules, USA) was used for real-time PCR analysis. The specificity of each PCR was determined by the melting curve analysis. The following primers were used for quantitative real-time PCR. Cx30.3 (NM_053984) primers: forward: CCCAATGTCTGCTATGACGA; reverse: CACAGCAGCCTTGAAGATGA, Cx31 (NM_019240) primers: forward: TTGAGCGGTGTGAACCAGTA; reverse: TGTTGGAGATGGGGAAGAAG, Cx31.1 (NM_019241) primers: forward: CATCGTCTGCATCCTGCTTA; reverse: ATGAGGTCGCTTGAGAGGAA, Cx32 (NM_017251) primers: forward: AGAATCATGGTGCTGGTGGT; reverse: CCTCAAGCCGTAGCATTTTC, Cx37 (NM_021654) primers: forward: AGTGTCTGTACCTTGGATGCC; reverse: CAGCACACTTAGCCAAGAGC, Cx40 (NM_019280) primers: forward: ATACCATTCAGCCTGGTTGC; reverse: CGGCCTCTTTAGCTTTCTCA, Cx43 (NM_012567) primers: forward: AGCAAGCTAGCGAGCAAAAC; reverse: GAG TTCATGTCCAGCAGCAA, Cx45 (NM_001085381) primers: forward: GATCATCCTGGTTGCTACTC; reverse: GATC CTCTTCATGGTCCTCT, and cyclophilin A (Ppia) primers: forward: GGCAAATGCTGGACCAAACAC; reverse: TT AGAGTTGTCCACAGTCGGAGATG. The PCR was performed at a cycle of 95°C for 30 sec and cycles of denaturation at 95°C for 30 sec, annealing at melting temperature for 30 sec, and extension at 72°C for 30 sec. Each PCR was completed with an additional extension at 72°C for 30 sec.
Triplicated PCRs were performed for each cDNA, and three to four cDNAs were used for each experimental group. Following densitometric analysis, signal intensities of Cx isoforms were normalized to internal controls (Ppia). One-way ANOVA was carried out to check significant differences among experimental groups, and Duncan’s test, a post-hoc analysis, was performed to determine statistical significances between control and EB-treat or Flu-treated groups. When P value was lower than 0.05, it was considered to be significant.
RESULTS
Expression of Cx26 in the adult corpus epididymis was not changed by treatment of EB at low dose (Fig. 1A). However, compared with that of control, the treatment of high-dose EB resulted in a significant decrease of Cx26 transcript level in the adult corpus epididymis (Fig. 1A). Interestingly, regardless of dose of administration, the treatments of Flu at 7 days of age caused significant decreases of Cx26 expression in the adult corpus epididymis (Fig. 1A). Similar findings were observed in expression patterns of Cx30.3 (Fig. 1B). Even though there was no expressional change of Cx30.3 by low-dose EB treatment at 7 days of age, a significant decrease of Cx30.3 transcript level in the adult corpus epididymis was detected by highdose EB treatment at 7 days of postnatal age (Fig. 1B). Treatment of Flu at low- or high-dose at seven-day of old resulted in significant decrease of Cx30.3 expression in the adult corpus epididymis (Fig. 1B).
Treatment of low-dose of EB at 7 days of age didn’t give an influence on transcription of Cx31 in the corpus epididymis at the adult (Fig. 2A). However, a decrease of Cx31 transcript level was detected by high-dose EB treatment in the corpus epididymis (Fig. 2A). Exposure to lowdose Flu at 7-days old of age resulted in a significant decrease of Cx31 expression in the corpus epididymis (Fig. 2A). A further decrease of Cx31 expression was found in a treatment of high-dose Flu (Fig. 2A). Administration of EB at a low-dose at 7 days of age didn’t cause aberrant expression of Cx31.1 in the adult corpus epididymis, even though treatment of high-dose EB led to a significant decrease of Cx31.1 expression (Fig. 2B). Treatments of Flu at two doses resulted in significant decreases of Cx31.1 transcript levels, compared with that of control group (Fig. 2B)
A significant increase of Cx32 expression was found in the corpus epididymis treated with low-dose of EB at 7 days of age (Fig. 3A). However, treatment of high-dose EB caused a transient decrease of Cx32 transcript level in the adult corpus epididymis (Fig. 3A). A great decrease of Cx32 expression was detected with low-dose Flu treatment (Fig. 3A). Expression of Cx32 in the adult corpus epididymis was barely detected with a treatment of high-dose Flu (Fig. 3A). Interestingly, treatments of EB at 7 days of age caused expressional increases of Cx37 in the adult corpus epididymis (Fig. 3B). However, an administration of low-dose Flu resulted in a significant decrease of Cx37 expression, while there was no change of Cx37 transcript level with high-dose Flu treatment (Fig. 3B).
Expressional change of Cx40 in the adult corpus epididymis after exposure to EB at 7 days of age was only detected with high-dose EB treatment (Fig. 4A). Treatment of Flu at low- or high-dose resulted in significant decrease of Cx40 transcript level, compared with that of control (Fig. 4A). A significant decrease of Cx43 transcript level was observed with high-dose EB treatment, while no change of Cx43 expression was found in a treatment of low-dose EB treatment (Fig. 4B). Treatment of low-dose Flu at 7 days of age resulted in a significant decrease of Cx43 expression in the adult corpus epididymis (Fig. 4B). But, expression of Cx43 in the corpus epididymis was not influenced by high-dose Flu treatment (Fig. 4B). Expression of Cx45 in the adult corpus epididymis was significantly increased by low-dose EB treatment but was significantly decreased by high-dose EB treatment (Fig. 4C). Even though Flu treatments caused significant decreases of Cx45 expression in the corpus epididymis, a further significant decrease of Cx45 transcript level was detected with high-dose treatment of Flu (Fig. 4C).
DISCUSSION
Disruption of hormonal homeostasis by exogenous administration of EB or Flu to male commonly develops abnormal expression of a number of genes related with functions of the epididymis (Gorowska et al., 2014; Kaushik et al., 2010). In addition, neonatal exposure of steroidal compounds often results in permanent changes of male reproductive function at the adult (Goyal et al., 2003). The present study was designed to determine the effect of EB or Flu treatment at neonatal age on expression of Cx isoforms in the corpus epididymis of adult rats.
It is likely that treatment of low-dose EB at neonatal age doesn’t greatly affect expression of most Cx isoforms in adult corpus epididymis, except Cx32, Cx37, and Cx45, which were significantly increased. These findings were somewhat different from those observed in the initial segment (IS), which treatment of low-dose EB caused significant increases of Cx30.3, Cx31.1, and Cx43 expression but no other Cx isoforms (Lee, 2014). These results suggest that expression of Cx isoform in the IS and corpus epididymis is differentially regulated by low-dose EB. The level of estrogen receptor (ER) α along the epididymis varies with the highest at the corpus than other epididymal regions (Hess et al., 2011). Such differential levels of ERα among the epididymal segments would contribute to differrent expressional patterns of Cx isoforms induced by lowdose EB treatment. It is also possible that responsiveness to low-dose EB on expression of Cx isoform would be different among epididymal regions. At this moment, the current findings couldn’t provide firm evidence to answer such differential expression of Cx isoforms by low-dose EB treatment between the IS and corpus epididymis. Molecular dissection of promoter regions of Cx isoforms would offer a possibility to understand how such differential responsiveness on expression of Cx isoforms to low-dose EB occurs within different epididymal regions.
Exposure to high-dose EB at the neonatal age generally led to significant decreases of Cx isoforms in adult corpus epididymis, except Cx37 with a significant increase. These results relatively differ from those detected in the IS, which expression of Cx isoform in the adult after neonatal high-dose EB treatment didn’t show any specific pattern (Lee, 2014). Aberrant expression of Cx isoform by highdose EB would be partly explained by differential responsiveness of Cx genes at the dose of EB. From the findings from current study, it is generally considered that treatment of EB at 1.5 mg /kg BW at 7 days of age is sufficient to suppress expression of most Cx isoforms in adult corpus epididymis, even though an exception is Cx37. One might think that the treatment of high-dose EB at neonatal age has a disruptive effect on general hormonal balance and thus causes expressional decreases of most Cx isoforms. But, because expression pattern of Cx37 is not the case, it is more thoroughly considered that expressional regulation of Cx37 by EB would differ from other Cx isoforms in the corpus epididymis.
Administration of low-dose Flu at 7 days of age resulted in significant expressional decreases of all Cx isoforms in adult corpus epididymis. Even though the same treatment of Flu results in similar results in the IS, expression of some Cx isoforms in the IS are not changed or significantly increased (Lee, 2014). These conflict results observed between the IS and corpus epididymis would be fairly explained by segment-specific expressional regulation of some Cx isoforms by low-dose Flu. The level of androgen receptor (AR) in the corpus epididymis is the lowest among epididymal segments (Pujol & Bayard, 1979). As an antiandrogenic compound, the Flu acts on suppression of AR signaling pathway. Thus, it is reasonable to think that expression of Cx isoforms in the corpus epididymis is up-regulated by androgen. And, disruption of hormonal homeostasis by exogenous exposure of an antiandrogen at the neonatal age could result in permanent defect on expression of Cx isoforms in the adult. Additional researches are suggested to resolve androgenic regulation on expression of Cx isoforms in the corpus epididymis.
Expression of Cx isoforms in adult corpus epididymis after high-dose Flu treatment at neonatal age is somewhat unusual. As might expected, expression of most Cx isoforms is significantly lower than the control or further decreased than that with low-dose Flu treatment. However, the levels of Cx37 and Cx43 do not differ from those of control. These observations are surprisingly and are not simply answered with the findings obtained from present research. A possible suggestion would be addressed from negative dose-dependent expressional regulation of genes. Also, it is considerable that high-dose Flu could influence different signaling pathway at which low-dose Flu does not give an impact. But, it is clear that expressional regulation of Cx37 and Cx43 by androgen is more complicate than expected. More detailed examination is required for providing defined data on Cx37 and Cx43 expression in the corpus epididymis.
In conclusion, the present research has clearly demonstrated that neonatal exposure to EB or Flu results in aberrant expression of Cx isoforms in adult corpus epididymis. The epididymis is a major site for sperm maturation, and Cx is particularly important for communicating between different cell types, such as the epididymis. Even though it is not considered at the present research, additional investigations are suggested to examine the effect of EB or Flu treatment at neonatal age on male fertility.
